ID: 983519549

View in Genome Browser
Species Human (GRCh38)
Location 4:168693010-168693032
Sequence ATTTGGATGAGGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901
Summary {0: 1, 1: 0, 2: 11, 3: 76, 4: 813}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983519549 Original CRISPR ATTTGGATGAGGAGGGAGGA AGG Intronic
900779596 1:4609119-4609141 AGCTGGACCAGGAGGGAGGATGG - Intergenic
900857455 1:5197408-5197430 ATTTGGTGGGGGAGGGGGGATGG + Intergenic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901590208 1:10335039-10335061 AGGTGGCTGAGGTGGGAGGATGG - Intronic
902652261 1:17844559-17844581 GCTGGGAGGAGGAGGGAGGAGGG + Intergenic
902802977 1:18841845-18841867 ATAGGGATCTGGAGGGAGGAGGG + Exonic
902821295 1:18944921-18944943 AAGAGCATGAGGAGGGAGGAGGG + Intronic
902993675 1:20207227-20207249 GGTGGGATGTGGAGGGAGGAGGG - Intergenic
903380835 1:22895961-22895983 CTTAGGAGGAGGAGGGGGGAGGG + Intronic
903681189 1:25098415-25098437 ATTTGGATAAGTAGAGAAGAAGG + Intergenic
904016883 1:27428528-27428550 AGGTGGAGGGGGAGGGAGGAGGG + Intronic
904042036 1:27590718-27590740 ATTGTGATGAGTAGGGCGGAGGG - Intronic
904087179 1:27917083-27917105 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
904381523 1:30114343-30114365 ATTTGGATGAGCTGGGATGTGGG + Intergenic
904384079 1:30130289-30130311 AGCTGGCTGAGGAGGGAGGCTGG + Intergenic
904501446 1:30915095-30915117 AGCTGGGTGAGGAGAGAGGAGGG + Intergenic
904563925 1:31415918-31415940 CTTTGGATGGGGAGGTAAGATGG + Intronic
904593913 1:31631048-31631070 ATTTGGAGAAAGAGGGATGAGGG - Intronic
905242228 1:36588641-36588663 ACAAGGATGAGCAGGGAGGATGG - Intergenic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905450482 1:38052903-38052925 GTTTGGGTGGGGTGGGAGGAAGG + Intergenic
905840293 1:41170799-41170821 ATTTGAATGAGGAGATAGTATGG - Intronic
905842145 1:41190542-41190564 ATTAGGAGGAAGAGGGAGGCTGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
905942918 1:41878682-41878704 AGAGGGAGGAGGAGGGAGGAGGG - Intronic
906101994 1:43269968-43269990 ATTTGAGTGAACAGGGAGGAGGG - Intronic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906693427 1:47808433-47808455 AATTGGATGGGGAGTGATGAAGG + Intronic
907079940 1:51612074-51612096 AATTAAATGAGGAGGGAGTAAGG - Intronic
907201636 1:52731905-52731927 AGTTGGATGAGGCGGGAGGATGG - Intronic
907464064 1:54623566-54623588 ATTGGGGCGGGGAGGGAGGAGGG - Intronic
907962793 1:59298371-59298393 ATTTTGAGGGGGAGGGAGGTTGG + Intronic
908027921 1:59970992-59971014 ATTTGCATAAGGCAGGAGGATGG + Intergenic
908193606 1:61727711-61727733 TTTTGGAGGGAGAGGGAGGACGG - Intergenic
908253079 1:62280489-62280511 ATTTGGAAGAAGAGGCAGGGCGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
911001879 1:93174640-93174662 ATTTACTTGAGGAGGGAGGGTGG - Intronic
911664106 1:100534898-100534920 AGTGGGATGAGGAGGGAGAGAGG + Intergenic
912078304 1:105906359-105906381 ATTTGTATGAGGGAGGAAGAAGG + Intergenic
912149765 1:106843796-106843818 TTTTGGGTCAGGAGGGAGGCTGG + Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912510726 1:110188588-110188610 ATTTGAGAGAGGAGGGAGGGAGG - Intronic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912897902 1:113612450-113612472 AGGAGGATGAGAAGGGAGGAAGG + Intronic
913211483 1:116586275-116586297 TTTTGGATGGGGAGGGAGAAAGG - Intronic
914258466 1:145979295-145979317 GTCTGGAAGAGGAGGGAGTATGG - Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914343731 1:146780880-146780902 CTTTTGATGAGGAAGCAGGAAGG - Intergenic
914375864 1:147073059-147073081 ATTAGGATTGGGAGGGAGGGAGG + Intergenic
914385202 1:147162473-147162495 AAGTAGATGAGGAGGAAGGATGG + Exonic
914706941 1:150177935-150177957 ATATTTATGAGGAGGGAGGTGGG - Intergenic
914788227 1:150852779-150852801 ATTTTGATGATGATGGAGAAGGG - Exonic
915035320 1:152918759-152918781 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
915148087 1:153807373-153807395 AGAAGGATGAGGAAGGAGGAGGG + Exonic
915226924 1:154418484-154418506 ATGTGGGGGAGGAGGGAGCAGGG + Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915839074 1:159201091-159201113 TTTGGAATGGGGAGGGAGGAGGG + Exonic
915974297 1:160375006-160375028 AGTGGGAAGAGGAGGGAGCAGGG + Intergenic
916973906 1:170053813-170053835 ATTTGGATAAGGTGTAAGGAAGG - Intronic
917166620 1:172119573-172119595 ATTTGGGTGAGAAGAGAAGAGGG - Intronic
917546869 1:175979180-175979202 TTTTGGGGGAGGAAGGAGGAGGG - Intronic
917708651 1:177660609-177660631 ATTTGGAGGAGGAGTGAGTAGGG - Intergenic
918381286 1:183958195-183958217 ATTTGAGTGAGGTGGGAGAAGGG - Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918674208 1:187261552-187261574 CCTTGAATGAGGAAGGAGGATGG + Intergenic
919102562 1:193112465-193112487 ATGGGGCTGAGGTGGGAGGATGG - Intergenic
919982043 1:202647826-202647848 ATTTGGAGGGGGAGGGAGGAGGG - Intronic
920092428 1:203464131-203464153 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
920215082 1:204357292-204357314 ATCTGGATGTGGAGGGAGTCTGG + Intronic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
921158437 1:212455791-212455813 TTTGGGGTGAGGTGGGAGGAAGG + Intergenic
921812190 1:219527635-219527657 AGTGGGAAGAGGAGGGAGGCAGG + Intergenic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
922017750 1:221669081-221669103 ATTTGAATGGGGAGGGAGGTAGG - Intergenic
922137622 1:222846613-222846635 AATTGGATGGGGAGTGAGCATGG + Intergenic
922170467 1:223150332-223150354 AGCTGAGTGAGGAGGGAGGATGG - Intergenic
922512607 1:226182124-226182146 AGGAGGATGAGGTGGGAGGATGG + Intronic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923679341 1:236106547-236106569 ATTTGGCTGAGGCAGGAGAATGG + Intergenic
924191529 1:241557721-241557743 GGTAGGCTGAGGAGGGAGGATGG + Intronic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924451201 1:244180708-244180730 ATTATGATGAGGACGGAGGAAGG - Intergenic
924608658 1:245556254-245556276 AAGAGGAGGAGGAGGGAGGAAGG - Intronic
924608667 1:245556292-245556314 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924608678 1:245556338-245556360 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
924901991 1:248410996-248411018 ATTTGGAAGAGTTTGGAGGAGGG + Intergenic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063448253 10:6133883-6133905 CTTCGGATGAGGATGGAGGCGGG + Intergenic
1063482143 10:6385325-6385347 AGTGGGAGGAGGAGGGAGGTGGG - Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064423539 10:15210599-15210621 ACCTAGATGAGGAGGGACGAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066116040 10:32241173-32241195 AGGAGGATGAGGTGGGAGGATGG - Intergenic
1066394799 10:35009083-35009105 AATTGTATGTTGAGGGAGGAGGG + Exonic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1066809104 10:39302138-39302160 ATTTGGAAGAGTAGTTAGGATGG - Intergenic
1067270953 10:44790895-44790917 GTTTAGATAAGGAGGGAGAAAGG - Intergenic
1067361008 10:45578461-45578483 AATGGGATGTGGAGGGAGGAGGG + Intronic
1067557820 10:47284898-47284920 AGAAGGAGGAGGAGGGAGGAAGG + Intergenic
1067698946 10:48555056-48555078 ATTGGGATGTGGCAGGAGGAAGG - Intronic
1068255186 10:54500291-54500313 ACTTGAAGGGGGAGGGAGGAGGG + Intronic
1068491654 10:57732030-57732052 GTTTGGCTCAGGAGGCAGGAGGG - Intergenic
1068889637 10:62135303-62135325 AGGAGGATGAGGTGGGAGGATGG + Intergenic
1069070415 10:63986110-63986132 ATTTGGCTGAGGAGTGAAGTAGG - Intergenic
1070399585 10:76041667-76041689 GTTTGGAGCATGAGGGAGGAGGG - Intronic
1070737874 10:78876883-78876905 ATGGGAATGAGGAGGAAGGAAGG - Intergenic
1071091566 10:81924878-81924900 GTTTTGAGGATGAGGGAGGAGGG + Intronic
1071203814 10:83251734-83251756 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1071529253 10:86376780-86376802 AGTTGAATAAGGAGGAAGGAGGG + Intergenic
1072770473 10:98133624-98133646 ATATTAATGAGTAGGGAGGAGGG + Intergenic
1072828290 10:98630525-98630547 ATGTGGATGAGAAGTGAGCAGGG - Intronic
1073306112 10:102504404-102504426 ATTTGTGGGAGGTGGGAGGAGGG + Intronic
1073381705 10:103082757-103082779 TTTTGGATGAGGATGGAGGCAGG + Exonic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074124934 10:110521355-110521377 CTTGGGATGCGAAGGGAGGACGG - Intergenic
1075366202 10:121892393-121892415 ATTTGGGGGAGAAGGGAGGAGGG + Intronic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1076008228 10:126965266-126965288 AGTCGGAGGCGGAGGGAGGAAGG + Intronic
1076428813 10:130387473-130387495 AGAGGGAAGAGGAGGGAGGACGG + Intergenic
1076748644 10:132528327-132528349 ATTTGGTGGAGCAGGGAGGCAGG + Intergenic
1076838416 10:133032729-133032751 ATTCCCATGAGGAGGGAGAAGGG - Intergenic
1077307179 11:1873636-1873658 AATGGAAGGAGGAGGGAGGAGGG + Intronic
1077491715 11:2863864-2863886 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1077812108 11:5648399-5648421 AGTTGGCTGAGGCGGGAGAATGG + Intergenic
1077885558 11:6385054-6385076 AGTAGGAAAAGGAGGGAGGAGGG - Intergenic
1077975122 11:7239755-7239777 GATTGGATTAGGAGGGAGAAGGG + Intronic
1078107028 11:8365022-8365044 ATTGGGCTGAGATGGGAGGAAGG + Intergenic
1078111020 11:8392438-8392460 ACTTTGATGAGGGGGTAGGAGGG - Exonic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078877794 11:15415462-15415484 AGTGGGAGGAGAAGGGAGGAGGG + Intergenic
1079088577 11:17464813-17464835 ATCTGGTCTAGGAGGGAGGAGGG - Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1079357823 11:19744457-19744479 ACATGGCTGAGGATGGAGGAAGG + Intronic
1079878600 11:25893771-25893793 ATTTTGAGGTGGAGGGAAGAAGG + Intergenic
1081100071 11:38990250-38990272 ATTTAGATGAGGTAGGATGATGG - Intergenic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081489177 11:43554135-43554157 GTTGGGTTGAGGAGGGAGGAGGG + Intergenic
1081641102 11:44755139-44755161 GGTGGGATGAGGAGGGTGGAAGG - Intronic
1082757807 11:57095423-57095445 GTATTGATGTGGAGGGAGGAGGG + Intergenic
1083413071 11:62506867-62506889 ATTTTGGGGAGGAGGGAGTAGGG - Intronic
1083964616 11:66035790-66035812 ATTGGGATGAAGGTGGAGGATGG + Intergenic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084762418 11:71282546-71282568 AATTGAATGAAGAGGGGGGACGG - Intergenic
1084888865 11:72226795-72226817 ATTAGGCTGGGGAGGGAGGCAGG + Intronic
1085079880 11:73625303-73625325 GTTTGGATGGGGAGTGGGGAGGG - Intergenic
1085207360 11:74744038-74744060 ATGTGGATGAGGAGTGAGGAAGG + Intergenic
1085752891 11:79177610-79177632 AGTGGGATAAGGAGGAAGGAGGG + Intronic
1085822443 11:79807064-79807086 GGTTGGAGGAGCAGGGAGGACGG + Intergenic
1086260180 11:84930545-84930567 AGTGGAATGAGGATGGAGGAAGG - Intronic
1086421166 11:86638883-86638905 ATTTTGATGAGGAGGCAAGTCGG - Intronic
1086435253 11:86773661-86773683 ACTTGGCTGAGTAGGGAGGGAGG + Intergenic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087784225 11:102336487-102336509 AAGAGGATGAGGTGGGAGGATGG + Intronic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088432325 11:109772418-109772440 ATTTGACTGAGGAAGGAGTAAGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089602576 11:119624532-119624554 CCTTTGATGAGGAGGCAGGAGGG - Intronic
1089791156 11:120945159-120945181 ACCTAGATGAGGAGGCAGGAAGG - Intronic
1089874720 11:121708962-121708984 GCTTGGATGAGGGGGCAGGAGGG + Intergenic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1090738928 11:129639106-129639128 ACTTGTATGAGGAAGGAGGAAGG - Intergenic
1091269138 11:134293362-134293384 TTTGGGATGGGGAAGGAGGAGGG + Intronic
1091285793 11:134408195-134408217 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285815 11:134408277-134408299 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285827 11:134408318-134408340 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285839 11:134408359-134408381 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285852 11:134408400-134408422 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285864 11:134408441-134408463 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285876 11:134408482-134408504 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285888 11:134408523-134408545 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285900 11:134408564-134408586 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285912 11:134408605-134408627 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285924 11:134408646-134408668 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285936 11:134408687-134408709 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285948 11:134408728-134408750 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285960 11:134408769-134408791 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285972 11:134408810-134408832 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285984 11:134408851-134408873 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091285996 11:134408892-134408914 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091286009 11:134408933-134408955 AGTGGGGTGAGGAGGGAGGTGGG + Intronic
1091340769 11:134811648-134811670 AATTGGAGGAGGAGGGATGTGGG + Intergenic
1091542909 12:1478682-1478704 ACTTGGCTGAGGCAGGAGGATGG + Intronic
1091697087 12:2634998-2635020 ATTTGGAAGAGGAACGAGAAGGG + Intronic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1092132665 12:6123547-6123569 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1092208650 12:6632265-6632287 ATTTGAAAGAGGAGGCAGGCCGG - Intronic
1092254719 12:6920280-6920302 ATTTGGATTAGCAATGAGGAAGG + Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092507648 12:9120462-9120484 ATTAGGATTAGGAGGTAGGTGGG + Intergenic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1093542105 12:20299338-20299360 ATTTGGGTGAAGGGGGAGGAAGG - Intergenic
1093993252 12:25613832-25613854 AGATGGATGATGTGGGAGGAGGG + Intronic
1094112801 12:26879523-26879545 ATTTGGAGGATGGGGGAGGGTGG - Intergenic
1094790646 12:33910377-33910399 ACTTGAATGTGGAGGGTGGAAGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096257785 12:50073534-50073556 ATTTGCAGGAGGAAGGGGGAAGG - Intronic
1096675702 12:53224713-53224735 AGTGGCAGGAGGAGGGAGGAGGG - Intronic
1096741510 12:53697034-53697056 AAATGGATGGGGAGAGAGGATGG - Intergenic
1096918794 12:55061621-55061643 TTTAGGAAGAGAAGGGAGGAGGG - Intergenic
1096977173 12:55706199-55706221 AGATGGAGAAGGAGGGAGGAAGG + Intronic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097172279 12:57122964-57122986 ATAGGGATGAGCAGGGTGGAGGG + Intronic
1097188671 12:57209248-57209270 CTTTGGCTCAGTAGGGAGGATGG - Intronic
1097191386 12:57221181-57221203 ATGTGGGTGAGGAGAGAGGTGGG - Intronic
1097249205 12:57623150-57623172 CCTTGGATGAGGAGAAAGGATGG + Intronic
1097769784 12:63570431-63570453 AGTTGGAAGAGTAGGTAGGATGG - Intronic
1097933109 12:65212571-65212593 AATTGGCTGAGGATTGAGGAGGG + Intronic
1098116548 12:67184740-67184762 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1098387045 12:69930500-69930522 ATTTGGAGGAGGAGAGGGAAAGG + Intronic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1099924727 12:89003492-89003514 ATTTGGGGGAGGAGGGTGGTAGG + Intergenic
1100114743 12:91290874-91290896 ATTTGAAGGTGGAGGGTGGAAGG - Intergenic
1100258238 12:92906009-92906031 AGTAGGCTGAGGCGGGAGGATGG - Intronic
1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG + Intronic
1100788976 12:98109550-98109572 GTTTGGGTGAGTGGGGAGGAGGG + Intergenic
1100893514 12:99153539-99153561 ATATAGGTGAGGAAGGAGGATGG - Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1101729193 12:107412702-107412724 AGTGGGGTGAGGTGGGAGGAAGG + Intronic
1102697881 12:114814360-114814382 AGGAGGATGAGGTGGGAGGATGG - Intergenic
1103285581 12:119798590-119798612 ATTTGGATCAGTGGAGAGGAAGG - Intronic
1103947152 12:124532932-124532954 AGTGGGATTTGGAGGGAGGAGGG - Intronic
1103947180 12:124533020-124533042 AGTGGGATTTGGAGGGAGGAGGG - Intronic
1103958691 12:124593907-124593929 TTTTGGATGAGGAGGGAACATGG + Intergenic
1104316227 12:127704394-127704416 AAGAGGAGGAGGAGGGAGGAGGG + Intergenic
1104774816 12:131384872-131384894 GCTTGGACGAGGAGGGAAGAGGG - Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104871191 12:131997723-131997745 AGTAGGATGAGGAGGGAGTGGGG + Intronic
1105527359 13:21188296-21188318 ATGGGGATGATGATGGAGGAGGG - Intergenic
1105935918 13:25099030-25099052 ATTGGGAGGAGGAGGAGGGATGG - Exonic
1105983776 13:25545737-25545759 AGTAGGCTGAGGTGGGAGGATGG - Intronic
1106389964 13:29325511-29325533 AGGAGGAGGAGGAGGGAGGAAGG + Intronic
1107426046 13:40293781-40293803 GTTGGGATGAGGTGGAAGGATGG + Intergenic
1107553787 13:41499978-41500000 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
1107576234 13:41725666-41725688 ATTTGGAGGTGGATGGAAGATGG + Intronic
1107606828 13:42065715-42065737 ACTTGGGTGAGGAAGGAGGCCGG + Intronic
1107890062 13:44906261-44906283 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1107904257 13:45047627-45047649 ATTTGAATGAGGACTGAGGGAGG + Intergenic
1108274178 13:48791269-48791291 ATTCTGATGAGGAGGCTGGATGG - Intergenic
1108489707 13:50969255-50969277 ATGTGGATGAGAAGGAAGCAAGG - Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108586532 13:51874844-51874866 TTGTGGAGGAGGAGGGAGGCAGG - Intergenic
1109268643 13:60229460-60229482 AGTGTGATGGGGAGGGAGGAGGG - Intergenic
1109371375 13:61424464-61424486 ATTTGGGGAAGGAGAGAGGATGG + Intronic
1110093408 13:71484264-71484286 ATGAGGATGAGGCAGGAGGATGG - Intronic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1111086425 13:83380715-83380737 AGTGGGAGGAGGAGGAAGGAAGG - Intergenic
1111400864 13:87733114-87733136 ATATTGAGGAGGAGAGAGGAGGG + Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1112200502 13:97269480-97269502 CCCTGGATGAGCAGGGAGGAAGG - Intronic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1112494316 13:99893592-99893614 CTTTGGATTAGGCTGGAGGATGG - Exonic
1112855020 13:103757888-103757910 AGGTGGAGGAGGAGGCAGGAGGG - Intergenic
1112867928 13:103930116-103930138 ATTTAGAAGAGGAGTGAGGTGGG + Intergenic
1112993700 13:105546037-105546059 ACTTGGCTGAGCTGGGAGGATGG - Intergenic
1113172156 13:107516971-107516993 CTGTGGATGAAGAGGTAGGATGG + Intronic
1113304633 13:109064324-109064346 GTTTGGATGCAGAGGCAGGAAGG - Intronic
1113954344 13:114089240-114089262 GTTCGGAGGAGGAGAGAGGAGGG + Intronic
1114201222 14:20522576-20522598 AGAAGGAGGAGGAGGGAGGAGGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114547218 14:23512035-23512057 ATTGGGATGGGGGAGGAGGAAGG - Intergenic
1114560887 14:23589638-23589660 AATGGGCTAAGGAGGGAGGAGGG - Intergenic
1115709032 14:36029699-36029721 ATTTTGGTGAGGTGGGAGCAAGG + Intergenic
1115850937 14:37589470-37589492 CTCTGGAGGAGGTGGGAGGAGGG - Intergenic
1117096762 14:52306388-52306410 AGGTGGTTGAGGCGGGAGGATGG + Intergenic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1117957060 14:61130969-61130991 TCCTGGAGGAGGAGGGAGGAGGG - Intergenic
1117968339 14:61228396-61228418 CTTGCTATGAGGAGGGAGGAGGG - Intronic
1118107680 14:62678690-62678712 ATATGGAGGTGGAGGGAGGAAGG + Intergenic
1118313106 14:64707144-64707166 CTTCTGCTGAGGAGGGAGGATGG - Intronic
1118377321 14:65188395-65188417 ATTTGGCTGAGGGGGTGGGAAGG + Intergenic
1118386818 14:65262717-65262739 ATTTGGCTGAGGCAGGAGAATGG - Intergenic
1118444152 14:65836808-65836830 ATTTGGTGGAGGAGGAAAGACGG + Intergenic
1119143949 14:72293514-72293536 AAATGGATGGGGAGGAAGGAAGG - Intronic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120059196 14:79961746-79961768 ACTAGAATGGGGAGGGAGGAAGG - Intergenic
1120415351 14:84212665-84212687 ACTTGAAGGTGGAGGGAGGATGG - Intergenic
1120800431 14:88682551-88682573 AACCAGATGAGGAGGGAGGAAGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121241135 14:92430808-92430830 ATCTGAAGGTGGAGGGAGGAGGG - Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121577277 14:94998424-94998446 ATTTGGAGAAGGAAGTAGGAGGG + Intergenic
1121864911 14:97353719-97353741 ATGTGGCTGAGGAGGAAGAAAGG - Intergenic
1121873336 14:97429335-97429357 ATTGGCATGAAGAGGGAGCAAGG + Intergenic
1122948077 14:105022517-105022539 ATTTGGAGGAGGTGGCAGGAAGG + Intergenic
1123756759 15:23402877-23402899 ATTTGCAGGAGGAGGGAAGGAGG + Intergenic
1123802303 15:23834128-23834150 ATTTGGTGGTGGATGGAGGATGG - Intergenic
1125201875 15:37107268-37107290 ATTTGGTGGAGGTGGGGGGAGGG - Intergenic
1125475591 15:40046205-40046227 ATTTTGATGGGGAGGGAGGGAGG - Intergenic
1125833291 15:42730887-42730909 ATTCTGGTGAGGAGGGAGCAGGG - Intronic
1125903468 15:43370227-43370249 ATTTGGAGGAGGTGGGAGAGGGG - Intronic
1126057722 15:44747364-44747386 ACTTGTATGAGGATGGAGGCAGG - Intronic
1126321912 15:47434191-47434213 ATTTGGAGGCTGAGGGAGAAAGG + Intronic
1126356689 15:47803534-47803556 ATTTGGAATAGAAGGGAGGAAGG + Intergenic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1127857895 15:62967558-62967580 AATTGGGTAAGGTGGGAGGAAGG - Intergenic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128619828 15:69139349-69139371 ATTCAGATGAGGAAGGAGCAGGG - Intergenic
1128938974 15:71771576-71771598 AGTTGGCAGAGAAGGGAGGAAGG + Intronic
1129049554 15:72768867-72768889 ACTCGGCTGAGGTGGGAGGATGG + Intronic
1129950287 15:79581286-79581308 AATTGGCTGAGGTGGGTGGATGG + Intergenic
1130430476 15:83842213-83842235 AGATGGATGAGGAGGCAGAAGGG + Intronic
1130721100 15:86386257-86386279 AGGAGGAGGAGGAGGGAGGAGGG - Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131139826 15:89968116-89968138 AGGAGGAGGAGGAGGGAGGAGGG + Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1131852111 15:96554578-96554600 AGTAGGAGAAGGAGGGAGGAGGG - Intergenic
1132002879 15:98197533-98197555 ATTAGGATGAGAAGGCAGGGTGG - Intergenic
1132041024 15:98524729-98524751 ATTTGGATTTGCAGGGAGGGGGG + Intergenic
1132266655 15:100478928-100478950 ATTTGAAGGAGGAGGGTGTATGG + Intronic
1132535044 16:474627-474649 AGTGGGAGAAGGAGGGAGGACGG - Intronic
1133112101 16:3554185-3554207 CCTTGGAGGAGGAGGGAGAAGGG + Intronic
1133232836 16:4374513-4374535 ATTTAATTAAGGAGGGAGGAGGG + Intronic
1133634384 16:7652003-7652025 ATTTGCATGAGAAGGGAGGAAGG + Intronic
1133634429 16:7652251-7652273 ATTTGCATGAAATGGGAGGAAGG + Intronic
1134887160 16:17803896-17803918 ATTTGGATGAGAAGAGAGAAGGG + Intergenic
1135246722 16:20863071-20863093 AGTAGGATGAGTAGGGAGAAGGG + Intronic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135943498 16:26843258-26843280 ATTGGCAGGAGGAGGGAAGAAGG + Intergenic
1136024249 16:27459898-27459920 TTCTGGATGAGGAGGGACAAAGG - Intronic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136138863 16:28276054-28276076 AAGTGGAGGAGGAGGGAGGCTGG + Intergenic
1136221078 16:28829384-28829406 ATTGGACTGGGGAGGGAGGAAGG - Exonic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1137093337 16:36221845-36221867 ATTTAGATGCGAAGGAAGGAAGG + Intergenic
1137710366 16:50562750-50562772 AGAGGGATGAGGGGGGAGGAGGG + Intronic
1137934563 16:52622130-52622152 AGGTGGATGAGAAGGGAGGCAGG + Intergenic
1138220555 16:55246664-55246686 ATAAGTGTGAGGAGGGAGGATGG - Intergenic
1138458321 16:57133652-57133674 TTTTCAATGAGGAGGGTGGAGGG - Intronic
1138794155 16:59947373-59947395 AGGTGGCTGAGGTGGGAGGATGG - Intergenic
1139132454 16:64162773-64162795 ATTGGGATCAGGAAGGAGAAAGG - Intergenic
1139165757 16:64563339-64563361 AGGTGGAGGAGGAGGGAAGAAGG + Intergenic
1139431323 16:66912429-66912451 ATCTGGAGGAGGAGGAGGGATGG + Exonic
1139692921 16:68652482-68652504 TGATGGAAGAGGAGGGAGGAAGG + Intronic
1139918206 16:70441010-70441032 CTTTTAATGTGGAGGGAGGAGGG - Intergenic
1139990261 16:70934454-70934476 CTTTTGATGAGGAAGCAGGAAGG + Intronic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140168517 16:72579625-72579647 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1141105554 16:81230597-81230619 ATTTGGATGGGGAAGGAGGAGGG - Intergenic
1141134125 16:81454856-81454878 ATCTGGATGGAGAGGTAGGATGG + Intronic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141664131 16:85457193-85457215 ATAAGGATGAGGAGAGTGGAAGG + Intergenic
1141775759 16:86121749-86121771 AGGAGGAGGAGGAGGGAGGAAGG - Intergenic
1142262623 16:89049996-89050018 ATTCGGAGGTGGAGGGAGGAGGG + Intergenic
1203142941 16_KI270728v1_random:1780692-1780714 ACTGGGATGAGGAGGGAGCCGGG + Intergenic
1142523476 17:521059-521081 ATTTTGAAGAGTAGGGATGAGGG - Intronic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143737476 17:8923029-8923051 AATGGGATGAGGATGAAGGAGGG + Intronic
1143772638 17:9178450-9178472 ATTAGGAAGAGGAGGGAGGGAGG - Intronic
1144202776 17:12956228-12956250 ATTGGGATGAGGGGAAAGGAGGG + Intronic
1144868479 17:18352713-18352735 AGTAGGCTGAGGTGGGAGGATGG + Intronic
1144877700 17:18411054-18411076 AAAAGGATGGGGAGGGAGGAGGG - Intergenic
1144958023 17:19029392-19029414 ATTTGGACCAGGTGGGAGAAGGG - Intronic
1144977135 17:19145128-19145150 ATTTGGACCAGGTGGGAGAAGGG + Intronic
1145154529 17:20533349-20533371 AAAAGGATGGGGAGGGAGGAGGG + Intergenic
1145962490 17:28895718-28895740 ATTTGGATGGGGTCGGGGGATGG - Intronic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1146815643 17:35939858-35939880 ATTGGGATGGGGAGTGAGGTTGG + Intronic
1146944073 17:36862435-36862457 TTTAGGATGGGGAGGGAGGTGGG - Intergenic
1147139968 17:38455343-38455365 AGTTGGAAGAGGTGGGAGGAAGG + Intronic
1147322044 17:39652505-39652527 ATTTGGAGCAGGAGGGTGGGAGG + Intronic
1147627989 17:41912213-41912235 GTTTGGATGATGAGGGAGCTGGG + Intronic
1147719332 17:42528999-42529021 AGTAGGCTGAGGTGGGAGGATGG - Intergenic
1147966451 17:44196875-44196897 ATTGGGATGAGGTGGGAAGCAGG - Intronic
1148104604 17:45112635-45112657 ATTTGGATGAAGAGCGTGGCTGG + Exonic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149441604 17:56678863-56678885 ATTTCGGGGAGGAGGGGGGAGGG - Intergenic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150725155 17:67645572-67645594 ATTTGGGGGAGGAGGGATGCAGG + Intronic
1151163004 17:72181584-72181606 GTTTGTGTGAGGTGGGAGGATGG - Intergenic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151562408 17:74877781-74877803 CTTTGGCTGAGGATCGAGGAAGG + Exonic
1152003756 17:77664098-77664120 CTTTGGATGAGGAGTCAAGATGG + Intergenic
1152124553 17:78438432-78438454 AGGAGGAGGAGGAGGGAGGAGGG + Intronic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1152859083 17:82685215-82685237 ATGGGGAGGGGGAGGGAGGACGG + Intronic
1154347301 18:13552599-13552621 GTTAGGAAGTGGAGGGAGGAGGG - Intronic
1155162345 18:23206181-23206203 AGTGGGATGAGGAGCGAGGAGGG - Intronic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156168002 18:34447064-34447086 ATTTGGAAGAGGTGTGAGGGTGG - Intergenic
1156833721 18:41527297-41527319 AGTTGGAGGAGGAGATAGGAAGG - Intergenic
1157212893 18:45759170-45759192 ATTTGTATCAGGTGGGAAGAGGG - Intergenic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1157659308 18:49425364-49425386 TTTTGTATGAGGTGTGAGGAAGG - Intronic
1157810776 18:50694271-50694293 ACGTGCATGAGGAGGGAGGATGG - Intronic
1158240042 18:55367342-55367364 GTTTGCAGAAGGAGGGAGGATGG - Intronic
1159096401 18:63907090-63907112 ATTTGCATGTGTATGGAGGAAGG - Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160582870 18:79897624-79897646 ATGTGGAGGAGGAGGAGGGAAGG - Intronic
1160678609 19:403422-403444 ACTTGGAAGTGGAGGGGGGAGGG + Intergenic
1160831713 19:1107499-1107521 ATGTGGATGAGAGGGGACGAGGG - Intergenic
1161389255 19:4012720-4012742 AGTTTGATGAGGAGGAGGGAGGG + Intronic
1161404040 19:4081918-4081940 AGAAGGAGGAGGAGGGAGGAAGG - Intergenic
1161404075 19:4082046-4082068 GCATGGAGGAGGAGGGAGGAGGG - Intergenic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162444399 19:10713277-10713299 ATTGGGAGAGGGAGGGAGGAAGG + Exonic
1162788489 19:13051050-13051072 ACTTGGCAGTGGAGGGAGGAGGG + Intronic
1163453990 19:17395234-17395256 AACAGGAAGAGGAGGGAGGAGGG - Intergenic
1163536733 19:17881210-17881232 ATTTGTCTGGGGAGGAAGGAAGG - Intronic
1163779753 19:19240065-19240087 ATGAGGAGCAGGAGGGAGGAGGG - Intronic
1164591893 19:29511977-29511999 AGGAGGATGAGGAGGAAGGAGGG + Intergenic
1164591965 19:29512274-29512296 ATGGGGATGAGGGGGAAGGAGGG + Intergenic
1164592027 19:29512503-29512525 ACAAGGATGAGGAGGAAGGAGGG + Intergenic
1164592304 19:29513526-29513548 AGGGGGATGAGGAGGAAGGAGGG + Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165856985 19:38885188-38885210 AGTGGGCTGAGGTGGGAGGATGG - Intronic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166398661 19:42461707-42461729 ATTAGGGTGGGGAGGGAGGAGGG - Intergenic
1166775776 19:45311665-45311687 TTTTGGTGGAGGAGTGAGGAGGG + Intronic
1166827404 19:45617926-45617948 ATTTAGAAGAGGAGTAAGGAGGG - Intronic
1167134934 19:47610194-47610216 GGATGGAGGAGGAGGGAGGAGGG + Intronic
1167189959 19:47979162-47979184 AGGAGGAGGAGGAGGGAGGAAGG - Intronic
1167419661 19:49395474-49395496 ATTTGGATGAGGAAGCAGAGGGG + Intronic
1167573375 19:50304940-50304962 ATTTGGAGGAGGAGTGTGGTTGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168078802 19:53994372-53994394 ATTTGGGAAAGGAGGGAGTATGG - Intronic
1168387861 19:55980833-55980855 ATTTGTAGGAGGAGGGATCATGG + Intronic
1168478064 19:56692369-56692391 ACATGGATGAGGAGTGAGGGTGG - Intergenic
925151012 2:1614974-1614996 ATTTGGAAGGGGAGGGAGTGGGG + Intergenic
925348782 2:3187628-3187650 AGGTGGATGAGGAGTGGGGAGGG - Intergenic
925985778 2:9213596-9213618 TCTTGGATGAGGAGGTAGCAGGG + Intronic
926292325 2:11541033-11541055 AGTTAGAAGAGGAGGGAGCATGG + Intronic
926554792 2:14344170-14344192 ATTTGTGTGGGGAGGGAGAAAGG - Intergenic
926782340 2:16484875-16484897 ATTTGGATAAGCAAAGAGGAAGG + Intergenic
926783015 2:16492760-16492782 ATTTGAAGGAGGAGGGTGGGAGG + Intergenic
927494925 2:23545881-23545903 CCTTGGATGAGGCGGGAGGAAGG - Intronic
927565924 2:24112935-24112957 ATTTGGAAGAAGAGTGAGTATGG - Intronic
927591841 2:24363356-24363378 ATAAGGATGAGGATAGAGGATGG - Intergenic
928126366 2:28619397-28619419 ATGTGGGTGAGGAGGGAGTGTGG + Intronic
928139678 2:28717757-28717779 GTTTGGATGAGGAGGGATGTAGG + Intergenic
928342645 2:30458501-30458523 TTTTGGATGAGTAGGGAGGTAGG + Intronic
928913433 2:36446207-36446229 ATTTGGATGGGAATGAAGGAGGG - Intronic
929075426 2:38075961-38075983 ATTGGGATGGGGACGGAGAAGGG + Exonic
929262213 2:39878354-39878376 ATTTGTATGAGGTGTTAGGAAGG - Intergenic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929823084 2:45289180-45289202 ATTTGCATGAGGAAGGTGGCAGG + Intergenic
929910952 2:46089178-46089200 ATAAGAATGAGGAGGGAGGAAGG - Intronic
929931090 2:46256028-46256050 ATGGGGATGAGGATGGAGCAAGG - Intergenic
930376509 2:50573950-50573972 ATGTGGATGAGGAGGGGTCATGG + Intronic
930380594 2:50622863-50622885 GTTGGGAGGAGGAGGGAGTAGGG + Intronic
930707719 2:54520981-54521003 TTTAGGAAGAGAAGGGAGGAAGG - Intronic
930781474 2:55228247-55228269 ATATGGTAGAGGAGGGATGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
931120122 2:59207179-59207201 AGGAGGATGAGGTGGGAGGATGG + Intergenic
931471121 2:62538596-62538618 AGTGGGCTGAGGTGGGAGGATGG + Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931792096 2:65672938-65672960 ATTTGCATGAGGATGGAGAAAGG - Intergenic
931964599 2:67519250-67519272 TCTTGGATGAGGAGGGTGGTGGG + Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
934534249 2:95119956-95119978 AGGTGGCTGAGGTGGGAGGATGG + Intronic
934724455 2:96606448-96606470 AGTCACATGAGGAGGGAGGAGGG + Intronic
934745428 2:96756486-96756508 GTGTGGATGATGAGGGAAGAAGG - Intergenic
935061673 2:99614067-99614089 ATTTGGAAAAGGTGAGAGGAGGG + Intronic
935178280 2:100668439-100668461 TTTGGGAAGAGGAGGGAGAATGG + Intergenic
935224573 2:101042173-101042195 ATGTTGATGAGGAGGAAAGAAGG + Intronic
935358466 2:102226756-102226778 AGATGGAGGAGAAGGGAGGAAGG + Intronic
936768844 2:115887466-115887488 GGATGGATCAGGAGGGAGGAAGG - Intergenic
936811128 2:116403714-116403736 ATCTGGCTGAAGAGGGAGGCAGG + Intergenic
936902974 2:117504819-117504841 AATTGGATGAGCAGGCACGAGGG + Intergenic
937020248 2:118644018-118644040 ATTTGAATGAGGGGGGAAAATGG + Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937397981 2:121555499-121555521 ATTTTGAGGAGGAGGATGGAGGG + Intronic
937416993 2:121723320-121723342 TTTGGGATGAGGAGGGAAGACGG + Intergenic
938891725 2:135712366-135712388 AAGTGGCTGAGGTGGGAGGATGG - Intronic
938962564 2:136356346-136356368 GGTTAGAAGAGGAGGGAGGATGG + Intergenic
939096519 2:137838993-137839015 AGTTCCATGAGGAGGGAGGATGG - Intergenic
939272483 2:139958625-139958647 ATTTGGATGATTAGGGAATAGGG + Intergenic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940638747 2:156327559-156327581 ATATGGAAGAGGAGGGGCGATGG + Intronic
940997862 2:160169753-160169775 AATTGGATGAGGTGGAATGAGGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941461059 2:165772478-165772500 AGGTGGCTGAGGTGGGAGGATGG + Intronic
942240076 2:173954486-173954508 ATTTGGTTGAGGAGTCAGGTTGG - Intronic
942641667 2:178067078-178067100 ATTTGGGAAAGGAGGGAGGGAGG - Intronic
943470783 2:188291950-188291972 ATTAGGAAGAGGAGGGAGGGGGG + Intronic
943728276 2:191274571-191274593 ATTTGGCAGATGAGGGAAGAAGG - Intronic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
944189436 2:196985475-196985497 ATTTGAATAAGAAGGGAGGCAGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944783949 2:203048470-203048492 TTTTTGATGGGGAGGGAGGGAGG + Intronic
944939553 2:204608731-204608753 ATATGCAGGAGCAGGGAGGAGGG - Intronic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
945606132 2:211934556-211934578 TTGTGGATGAGGTGGAAGGAAGG - Intronic
945819121 2:214641596-214641618 AGTTGAATGAGGAGGGAGGCAGG + Intergenic
946396131 2:219444600-219444622 AGTTGGAGGCAGAGGGAGGAGGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
947119370 2:226799654-226799676 AGGAGGAGGAGGAGGGAGGAGGG - Exonic
947439336 2:230104734-230104756 TTTTGGATGAGGTGTAAGGAAGG + Intergenic
947930074 2:233957382-233957404 AGGTGGCTGAGGTGGGAGGATGG + Intronic
947962653 2:234252671-234252693 ATCTGGATGGGGAAGGAGAAAGG + Intergenic
948091864 2:235301984-235302006 AGGAGGATGAAGAGGGAGGAGGG - Intergenic
948091948 2:235302218-235302240 AGAGGGAGGAGGAGGGAGGAGGG - Intergenic
948094912 2:235325626-235325648 ATTTGAATGAGAAAGGAAGAAGG - Intergenic
948344846 2:237287089-237287111 ATTTGGGTGGGGACAGAGGAAGG + Intergenic
948370447 2:237486371-237486393 TCTTGGAGGATGAGGGAGGAGGG + Intronic
948860728 2:240751479-240751501 ATTAGGGTGTGGAGGGAGCAAGG - Intronic
949037916 2:241826799-241826821 GTTTGGATGATGGGGAAGGACGG + Intergenic
1169369130 20:5015203-5015225 CTTTGGCTGGGGAGGGAGAATGG + Intergenic
1169672293 20:8115901-8115923 ATCAGGATGAGATGGGAGGAAGG - Intergenic
1170938270 20:20827971-20827993 AATGGAGTGAGGAGGGAGGAAGG + Intergenic
1171120322 20:22562885-22562907 TTTTGGAGGAGGAGGTAGGGAGG - Intergenic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172353073 20:34259103-34259125 AGGAGGATGAGGTGGGAGGATGG + Intronic
1172910508 20:38405890-38405912 GTGTGGCTGAGGTGGGAGGATGG + Intergenic
1173449847 20:43153622-43153644 ATTTGTTTGAGGAGATAGGATGG - Intronic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1173661364 20:44736325-44736347 ATTGGGAGAAGGAGAGAGGAAGG - Intergenic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174062642 20:47843543-47843565 ATGTGCTTGAGGATGGAGGAAGG + Intergenic
1174072993 20:47911952-47911974 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175091782 20:56510846-56510868 AGGAGGATGAGGTGGGAGGATGG + Intronic
1175234593 20:57501378-57501400 AGTTGGCTGAGGAGGGTGGGTGG + Intronic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1177276023 21:18913791-18913813 CTCTGGATGAGGAGAGAAGAGGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178442666 21:32611822-32611844 AATGGGCTGGGGAGGGAGGAGGG - Intronic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179150649 21:38805875-38805897 AGCGGGAGGAGGAGGGAGGAGGG - Intronic
1179324955 21:40333467-40333489 AGGTGGCTGAGGAGGGAGGATGG - Intronic
1179568266 21:42262615-42262637 ACTCGGAGGAGGAGGGAGGGAGG + Intronic
1179952672 21:44718896-44718918 ATTGGGATGGGGACAGAGGAAGG - Intergenic
1180179296 21:46110948-46110970 ACTTTGATAAGGAGGGAGGGAGG - Intronic
1180800621 22:18630268-18630290 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1180851853 22:19025825-19025847 CTTTGGAGGAGGAGGAAGGGTGG - Intergenic
1181065103 22:20301953-20301975 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1181221098 22:21364994-21365016 CTTTGGAGGAGGAGGAAGGGTGG + Intergenic
1181290130 22:21785513-21785535 AGGTGGCTGAGGTGGGAGGATGG + Intronic
1181313540 22:21958129-21958151 ACGAGGATGAGGATGGAGGACGG + Intronic
1181394358 22:22608993-22609015 ATTTGGAGGAGGAGAGAACAAGG + Intergenic
1181817350 22:25448477-25448499 ATATAGATGGGGAGAGAGGAAGG + Intergenic
1182253192 22:29018295-29018317 GATTGGATGTGGAGAGAGGAAGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183019716 22:35017540-35017562 ATTTGGATGTGGTGGGAGCCTGG - Intergenic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183371276 22:37433805-37433827 AGCTGGAGGAGGAGGAAGGAAGG + Intergenic
1183674412 22:39291634-39291656 GCTGGGATGAGGAGGGAGCAGGG + Intergenic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184193599 22:42911303-42911325 AGTAGGCTGAGGTGGGAGGATGG + Intronic
1184414145 22:44342356-44342378 CTTTGGAAGAGGAGAAAGGAAGG + Intergenic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
949118714 3:359647-359669 ACTTGGATCAGGAGTGGGGAAGG + Intronic
949202535 3:1395970-1395992 ATTGGGATGGTTAGGGAGGAAGG - Intronic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949576479 3:5343405-5343427 ATTTGAAGGGGGAGGAAGGAGGG + Intergenic
949872737 3:8603121-8603143 ATTTGGAGGAGAAGTGAGCAGGG - Intergenic
949895250 3:8763500-8763522 ATGAGGATGAGGAGGGAGTTTGG - Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950357359 3:12423014-12423036 AATTGCTTGAGGAGGGAGTAGGG + Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
950942714 3:16910032-16910054 AATTAGCTGAGGAGGGAAGAAGG - Intronic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951119231 3:18905039-18905061 ATTTGGATGGGATGGGAGGGAGG - Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
952355956 3:32584172-32584194 AGATGGAGGAAGAGGGAGGAAGG - Intergenic
953543397 3:43842276-43842298 ACTTGGATGAGTGGGGAGCATGG - Intergenic
953597652 3:44333550-44333572 ATTAGGATGAAGATGCAGGAGGG + Intergenic
953756751 3:45653230-45653252 ATTTGGATGAGGAGGGAGAGAGG + Intronic
953996010 3:47520475-47520497 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
953997656 3:47532675-47532697 AGTAGGCTGAGGTGGGAGGATGG - Intergenic
954080258 3:48209440-48209462 AGCTGGATGAGGAGACAGGAGGG - Intergenic
954221080 3:49154334-49154356 CTTTCTATGACGAGGGAGGAGGG + Intergenic
954876430 3:53805824-53805846 AGATGGAGGAGGAGGGAAGATGG - Intronic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955401817 3:58597362-58597384 CTTTGGATTGGCAGGGAGGAGGG + Intronic
955715549 3:61825747-61825769 AGGAGGATGAGGAGGGAGAATGG - Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
957001803 3:74895209-74895231 ATGTGGCTGAGCAGTGAGGAGGG - Intergenic
957673938 3:83342078-83342100 ATTTGGATAAGGGGTAAGGAAGG - Intergenic
958164907 3:89868203-89868225 ATTTGGATTAGGTGTAAGGAAGG - Intergenic
959032643 3:101318532-101318554 ACTTTGATGAGAAGGGAAGAAGG + Intronic
959250662 3:103939442-103939464 TTTTGGAAGGGTAGGGAGGAGGG - Intergenic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
960525942 3:118709654-118709676 ACTTGGAGTAGGAGTGAGGATGG + Intergenic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
961091862 3:124119756-124119778 AATTTGAGGAGTAGGGAGGATGG + Intronic
961372223 3:126438476-126438498 ATTGTCATGAAGAGGGAGGAGGG + Intronic
961758277 3:129145013-129145035 AGAAGGATGAGGTGGGAGGATGG - Intronic
961817095 3:129556688-129556710 ATTTCTATAAGGAGGCAGGATGG + Exonic
962168487 3:133076075-133076097 ATTTGGGTAAGGAGGAAGGCAGG + Intronic
962409362 3:135127927-135127949 GTTTGGGTGAGGAGGGAGTGTGG - Intronic
962539989 3:136371526-136371548 ATTTGTATAAGGTGTGAGGAAGG + Intronic
962622105 3:137190334-137190356 ATTTAGATGAGGCTGGGGGAGGG + Intergenic
963092502 3:141497620-141497642 AATAGGCTGAGGAGGGTGGATGG + Intronic
963245460 3:143055268-143055290 ATTGGGATGAGGAGGTGGGGAGG - Intronic
963390914 3:144663130-144663152 ATTTGTAAGAGGAGGGAGGCAGG - Intergenic
963801071 3:149676883-149676905 AGTTGACTGAGGAGGGTGGATGG - Intronic
964903128 3:161685420-161685442 ATTTGAATGAGTAAGAAGGATGG + Intergenic
965384222 3:168026615-168026637 ATGTGCATGGGGTGGGAGGAAGG - Intronic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965680188 3:171242310-171242332 ATGAGGAAGAGGAGGAAGGAAGG - Intronic
965766139 3:172132169-172132191 CGTTGGTTGAGGATGGAGGAAGG + Intronic
965842138 3:172918477-172918499 ATTTGGCTTCGGGGGGAGGAGGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966087357 3:176084743-176084765 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
966728021 3:183125788-183125810 AAGAGGATGAGGTGGGAGGATGG - Intronic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
967870946 3:194228602-194228624 AATTGCATGAGGTGGGTGGAGGG - Intergenic
968970383 4:3790604-3790626 ATCATGATGAGGTGGGAGGAGGG - Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969690458 4:8701443-8701465 ACTTGGGTGAGGAGAGAGGGAGG - Intergenic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
970990814 4:22210842-22210864 ATTTGGATGACGAGCAAGGTAGG + Intergenic
971138190 4:23893254-23893276 ATTTGGAGTAGGAGTGAGGAAGG - Intronic
971476854 4:27080635-27080657 ATTGGGATGAGCAAGGAGTAGGG - Intergenic
971510401 4:27417049-27417071 ATTTGGATAAGTAATGAGGAGGG + Intergenic
972115497 4:35628342-35628364 TTTTGGATGGGAAAGGAGGAAGG - Intergenic
972169213 4:36324277-36324299 AGTTGAAGGAGGAAGGAGGAGGG - Intronic
972288812 4:37672037-37672059 ATATGGATGTGTTGGGAGGATGG - Intronic
972657236 4:41076257-41076279 GTTTGGATGAGAAGACAGGATGG + Intronic
974543287 4:63267135-63267157 TTTTGTATAAGGAGGAAGGAAGG - Intergenic
976217556 4:82729331-82729353 TTCTGGAGGAGGAGGGAGGCTGG + Intronic
976371586 4:84294863-84294885 ATTTGAATGAGGAGGGGCTAGGG + Intergenic
976715333 4:88117213-88117235 GCTTGGGTGAGGTGGGAGGATGG + Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
977308438 4:95354582-95354604 ATAAGGCTGAGGTGGGAGGATGG - Intronic
978376723 4:108081732-108081754 AGTTGGATGAGGGGAGAAGAGGG + Intronic
978628466 4:110714910-110714932 AAGTGGCTGAGGTGGGAGGATGG + Intergenic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
979354599 4:119688056-119688078 ATTTGTATGAGGTGTGGGGAGGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980170272 4:129280974-129280996 ATTTCTATCAGAAGGGAGGAAGG + Intergenic
980268257 4:130548522-130548544 ATTTGGCAGAGAATGGAGGATGG - Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
982068889 4:151677927-151677949 AGAAGGAGGAGGAGGGAGGAAGG - Intronic
982438063 4:155400369-155400391 ACTTGGTTGAGGAGGGAGGACGG - Intergenic
982700519 4:158656199-158656221 ATTGGGATGAAGAGAGTGGAAGG - Intergenic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983127220 4:163968746-163968768 AGATGGAAGAGGAGTGAGGAAGG - Intronic
983519549 4:168693010-168693032 ATTTGGATGAGGAGGGAGGAAGG + Intronic
983742909 4:171157607-171157629 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
983827824 4:172286416-172286438 AATAGGATGAGGAGGGAGGATGG + Intronic
983868169 4:172792845-172792867 ATATAGATAAAGAGGGAGGAAGG - Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985229107 4:187796045-187796067 ATTTGAAGGGAGAGGGAGGAAGG - Intergenic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985790601 5:1925139-1925161 GTTCAGATGAGGAGAGAGGAAGG + Intergenic
985802075 5:2011095-2011117 ATTGCAATGAGGAGGGAAGAAGG + Intergenic
986398134 5:7351070-7351092 ATTGAGAGAAGGAGGGAGGAGGG - Intergenic
986765730 5:10924317-10924339 ATGTGGAGCAGGAGTGAGGAGGG - Intergenic
987046119 5:14110479-14110501 TTTGGGATGAGGTAGGAGGATGG + Intergenic
987101937 5:14598604-14598626 GTTAGGCTGAGGCGGGAGGATGG + Intronic
987776747 5:22376619-22376641 ATAAGGCTGAGGTGGGAGGACGG - Intronic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
987946371 5:24614398-24614420 CATTGGATCAGGAGGGAGCATGG - Intronic
988782533 5:34535893-34535915 ATTTGGAAGACTATGGAGGAAGG - Intergenic
988874584 5:35429964-35429986 GTTGGGCTGAGGTGGGAGGAAGG + Intergenic
988932448 5:36049630-36049652 ATTTGGATAAGGAGAGAAAAGGG - Intronic
988982651 5:36587001-36587023 GCTTGGAGGAGGAGGGAGTAGGG - Intergenic
989412847 5:41140312-41140334 GTTTGGGGGAAGAGGGAGGATGG + Intergenic
989437304 5:41429707-41429729 AATATGATAAGGAGGGAGGATGG + Intronic
989591714 5:43119069-43119091 AGCTGGATGGGGAGAGAGGATGG - Intronic
990200300 5:53365346-53365368 ATTTGGATGTGGACTTAGGACGG + Intergenic
990492576 5:56316980-56317002 ACTAGAATGAGGAGGGAGGGGGG + Intergenic
990569685 5:57065707-57065729 AAAAGGAGGAGGAGGGAGGAAGG - Intergenic
991410257 5:66338664-66338686 ATTTGGAAGAGGAGGTGGGTGGG + Intergenic
991647582 5:68816660-68816682 ATTTGAATGAGTGGGGAAGAAGG - Intergenic
991962407 5:72058347-72058369 ATCTGGCTGAGGAGGGTGGCTGG - Intergenic
992245778 5:74820861-74820883 ATATGGATTAGGAGAGAGGCAGG - Intronic
992770318 5:80041382-80041404 AATTTGATGGGGCGGGAGGAAGG + Intronic
993588186 5:89759095-89759117 ATTTGGATGAGGAGGTGGGAAGG - Intergenic
994868125 5:105305537-105305559 ATAGGGATAGGGAGGGAGGAGGG - Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
996001771 5:118372747-118372769 TTCTTAATGAGGAGGGAGGAAGG - Intergenic
996012337 5:118494852-118494874 TTTTGTATGAGGGGTGAGGAAGG - Intergenic
996022872 5:118611119-118611141 CTTGGGATTAGGAGGCAGGAGGG - Intergenic
996771521 5:127091663-127091685 TTCTGCATGAGGTGGGAGGAGGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
998733991 5:145113804-145113826 ATAAGGATGAGATGGGAGGATGG - Intergenic
999194432 5:149772379-149772401 ATTTGGCTGAGGAGGCTGCATGG + Intronic
999388652 5:151174036-151174058 ATCTGGAGGAGGAGGGGCGAAGG + Intergenic
999712724 5:154332646-154332668 AGATGCATGAGGAGGGAGGGAGG + Intronic
999820530 5:155223490-155223512 ATTGGGATGGGTGGGGAGGATGG - Intergenic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1001485995 5:172120041-172120063 ATGTGGAGGCGGTGGGAGGAGGG + Intronic
1001495228 5:172183380-172183402 ATTTTGAAGAGGAGGTAGAAAGG - Intronic
1002191135 5:177478263-177478285 ATTTGGATCAGCAGGGAGAGAGG - Intergenic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004275754 6:14233777-14233799 ATTTGGAAGGGCTGGGAGGATGG + Intergenic
1004377892 6:15106483-15106505 TTCAGGAGGAGGAGGGAGGATGG + Intergenic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1004518066 6:16337371-16337393 GCCTGGATGAGGAAGGAGGAGGG + Intronic
1004693688 6:18014353-18014375 ACTTGACTGAGGCGGGAGGATGG - Intergenic
1005490307 6:26341845-26341867 AGTTCGAAGAGGCGGGAGGAGGG + Intergenic
1005938877 6:30546156-30546178 ATGCGGATGAGGAGGGAGAAGGG - Exonic
1006457956 6:34142805-34142827 GGTTGGGGGAGGAGGGAGGAGGG + Intronic
1006686012 6:35834881-35834903 ATAAGGATGAGGAGGGGGAAAGG - Exonic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1008838690 6:55870036-55870058 ACTGGGATGAGAAGGGAGGAGGG + Intronic
1009198488 6:60715768-60715790 ACTAGAAGGAGGAGGGAGGAAGG + Intergenic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1011080405 6:83484509-83484531 AGGTGGCTGAGGTGGGAGGACGG + Intergenic
1011175908 6:84559941-84559963 AGTTGGAGAAGGAGAGAGGAAGG - Intergenic
1011179049 6:84598651-84598673 ATTTGGAAGGGGAGAGAAGATGG + Intergenic
1011406230 6:87018168-87018190 GTTGGGATGGGGAGGGAGAAAGG - Intergenic
1012068407 6:94579074-94579096 AGGAGGATGAGGCGGGAGGATGG - Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012685794 6:102246909-102246931 TTTTGTATGAGGTGTGAGGAAGG - Intergenic
1012688126 6:102277721-102277743 ATTAGAATGTGGAGGGAGGAGGG - Intergenic
1013276298 6:108587947-108587969 AGCTAGAGGAGGAGGGAGGATGG - Intronic
1013976276 6:116082380-116082402 ATTGGGATGGAGAGGGATGAGGG + Intergenic
1015114085 6:129627597-129627619 AAATTAATGAGGAGGGAGGAAGG + Intronic
1015421723 6:133018602-133018624 ATTTGGAGGAGAAGGAAGTAAGG - Intergenic
1015526043 6:134175870-134175892 ACTTGGAAGAGGAGGAAGGAAGG + Intronic
1015799611 6:137046891-137046913 TTTTTGGTGAGGAGGGAGTAAGG + Intergenic
1016395164 6:143616736-143616758 ATTTGGATAAGGAATGAGGTTGG + Intronic
1016445630 6:144129267-144129289 ACTTGAAGGAGGAGGGTGGAAGG + Intergenic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017011124 6:150064527-150064549 AGATGGGTGAGGTGGGAGGAAGG - Intronic
1017581693 6:155872031-155872053 AGGTGGCTGAGGTGGGAGGATGG - Intergenic
1017637366 6:156456204-156456226 ATGGGGAGGAGGGGGGAGGAAGG - Intergenic
1017637462 6:156456391-156456413 ATGGGGAGGAGGGGGGAGGAGGG - Intergenic
1018005219 6:159615801-159615823 ATAAGAATGAGGAAGGAGGATGG + Intergenic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018473243 6:164114772-164114794 AGGAGGATGAGGTGGGAGGATGG + Intergenic
1018481494 6:164195526-164195548 ATTTGAAAGTGGAGTGAGGATGG - Intergenic
1018776763 6:167024213-167024235 AGTTGAGTGAGGATGGAGGACGG + Intronic
1018844679 6:167547393-167547415 GATGGGGTGAGGAGGGAGGAGGG - Intergenic
1018844726 6:167547568-167547590 AATGGGATGAGGAGTAAGGAAGG - Intergenic
1019261532 7:84546-84568 CTCTGGGTGAGGAGTGAGGAAGG - Intergenic
1019326959 7:443230-443252 AGATGGATGAGAATGGAGGATGG + Intergenic
1019476410 7:1246770-1246792 ATTTGGGAGAGGAAGGAAGATGG + Intergenic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019764279 7:2838334-2838356 CTTTGGCTGAGGCAGGAGGATGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021207702 7:17805855-17805877 ATTTGTATTAGGAGGGAAGTGGG + Intronic
1021411036 7:20330488-20330510 ATTCGGGGGAGGAGGGAGAAGGG + Intergenic
1021717159 7:23470559-23470581 AGGAGGAGGAGGAGGGAGGAAGG + Intergenic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1022367119 7:29732349-29732371 AATTGGAAGAGGAGGTAGGATGG + Intergenic
1022851665 7:34269237-34269259 ATTTGGAAAGGGAGTGAGGAAGG + Intergenic
1022929056 7:35091528-35091550 AGTTGGAAGAGTAGGTAGGATGG - Intergenic
1022977808 7:35575009-35575031 ATCTGCAGGTGGAGGGAGGACGG - Intergenic
1023094102 7:36642620-36642642 ATTTGGATGATGAAAGAGCAAGG + Intronic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024213730 7:47228814-47228836 GTTTGGAGGTGGAGGGAGGCGGG - Intergenic
1024511836 7:50210725-50210747 ATTTGAAGGAGGTGGGAGGATGG + Intergenic
1024677252 7:51647775-51647797 ATGAGGAGGAGGAGGAAGGAGGG - Intergenic
1024944936 7:54799039-54799061 AGTGAGATGAGGAGGAAGGAGGG + Intergenic
1025108498 7:56193032-56193054 TTTGGGATGAGCAGGGAAGATGG + Intergenic
1025231806 7:57207599-57207621 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1025900055 7:65736750-65736772 ACTTGGCTGAGTTGGGAGGATGG + Intergenic
1026191908 7:68136497-68136519 AGAAGGAGGAGGAGGGAGGAGGG + Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027131010 7:75591454-75591476 TTTAGGATGAGGGGGGAGGTAGG - Intronic
1027143871 7:75680467-75680489 ATTTGAATGAGGCGAGAGGATGG - Intronic
1027364237 7:77440652-77440674 ATAAGGATGAAGAGGCAGGATGG + Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027823179 7:83075301-83075323 ATTTGGATGAGGAGTCAGTCAGG + Intronic
1028587599 7:92467486-92467508 ATTTGGAAGAGGAAGGATGTGGG + Intergenic
1028643335 7:93068664-93068686 ATTTGTATAAGGTGGAAGGAAGG + Intergenic
1028850537 7:95532675-95532697 GTTTGGATGAGAAGAGAGGCAGG + Intronic
1029075780 7:97932769-97932791 AGGTGGCTGAGGTGGGAGGATGG + Intergenic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029825167 7:103185210-103185232 AGTTGGAAGAGTAGGTAGGACGG - Intergenic
1029989885 7:104953364-104953386 CTTGGGAGGAGGTGGGAGGATGG - Intergenic
1030230865 7:107207207-107207229 AATAGGACGAAGAGGGAGGATGG - Intronic
1030436999 7:109534980-109535002 ACTTAGGTGAGGTGGGAGGAGGG - Intergenic
1030464682 7:109885605-109885627 ATTGGGAGGAGGTTGGAGGAGGG + Intergenic
1031644372 7:124205380-124205402 ATTTGGATAAGGCATGAGGATGG + Intergenic
1032981069 7:137283852-137283874 ATGTGTATGAGGGAGGAGGATGG - Intronic
1033242086 7:139688753-139688775 ATTTTGGTGAGGTGGGAGGTGGG - Intronic
1034068156 7:148156513-148156535 ATTCGGATGAGAAGACAGGAAGG - Intronic
1034071206 7:148187584-148187606 ATTTCTATGAGGAGCTAGGAGGG + Intronic
1035017483 7:155779214-155779236 ATTTGGAGTGGGAGGGAGGGGGG + Exonic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035245655 7:157560717-157560739 AATTGGGTGAGGTGGGAGGAGGG - Intronic
1035274280 7:157737989-157738011 AGATGGATGAGAAGAGAGGAGGG - Intronic
1035293176 7:157853059-157853081 ATCTGGAGGCGGAGAGAGGACGG - Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1038008057 8:23450979-23451001 ATTTGGAAGATGAAGGAAGAGGG - Intronic
1038342124 8:26695265-26695287 CATTGATTGAGGAGGGAGGAAGG - Intergenic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038659380 8:29483500-29483522 TTTTGGCTGAGGAGGGAGGATGG + Intergenic
1038660682 8:29494053-29494075 ATTTGAATGAGGAGAAAGGATGG - Intergenic
1038781822 8:30574721-30574743 ATTTGGGGGGCGAGGGAGGAGGG + Intergenic
1039099997 8:33930586-33930608 ACCTGGATGAAGAGGGAAGAAGG - Intergenic
1039504561 8:38042608-38042630 ATTTGGATGCAGACAGAGGAAGG - Intronic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1040772748 8:50998807-50998829 GCTTGGATGAGTAGGGAGAAGGG + Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1042312073 8:67388791-67388813 AGCAGGAGGAGGAGGGAGGAGGG - Intergenic
1043197685 8:77319272-77319294 ATTTGGATTAGCATTGAGGATGG + Intergenic
1043878230 8:85510665-85510687 AATTGGGTGTGCAGGGAGGAAGG - Intergenic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045281126 8:100750554-100750576 TTTAGGAAGAGGAGGGAAGAGGG + Intergenic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045344091 8:101279229-101279251 ACTAGGGGGAGGAGGGAGGAAGG + Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048357451 8:133665135-133665157 GTTTGCATGAGGAAGGAGGCAGG + Intergenic
1048823479 8:138400494-138400516 ATTAGAATGATGTGGGAGGAAGG + Intronic
1048968883 8:139633291-139633313 AGTTAGATAAGGAGTGAGGAGGG - Intronic
1049239241 8:141528580-141528602 AGTGGGCAGAGGAGGGAGGAGGG + Intergenic
1049276609 8:141723253-141723275 AAGAGGAAGAGGAGGGAGGAAGG - Intergenic
1049370357 8:142261350-142261372 AGTGGGAGGATGAGGGAGGAGGG + Intronic
1049958533 9:715413-715435 AGTTTGGGGAGGAGGGAGGAAGG - Intronic
1050615856 9:7401081-7401103 ATTTGCCTGGGGTGGGAGGAAGG - Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1051061587 9:13051583-13051605 ATTTGGATGAAGAGGGAAGGAGG + Intergenic
1051669250 9:19493815-19493837 GTTCCGATGAGGAGGGAAGATGG + Intergenic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052072331 9:24096868-24096890 CTTGGGAAGAGGTGGGAGGATGG + Intergenic
1052188036 9:25622554-25622576 ATTTTGGTGAGCAGTGAGGATGG + Intergenic
1052721349 9:32174773-32174795 ATCTGGATGATTAGGGAGGAAGG - Intergenic
1052820172 9:33132220-33132242 AGTGGGAAGAGGAGGGAGGGAGG + Intronic
1052842826 9:33307906-33307928 AGGAGGATGAGGTGGGAGGATGG - Intronic
1053082125 9:35185019-35185041 ATATGTTTGAGGTGGGAGGAAGG - Intronic
1053342453 9:37349126-37349148 AATTGAATGAGGAGGGAAGAAGG + Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053474941 9:38375877-38375899 TATTGGTTGAGGATGGAGGATGG - Intergenic
1054340717 9:63859612-63859634 ATTTGGGTGAAGACGGAGGTGGG - Intergenic
1054924424 9:70575182-70575204 TTTAAAATGAGGAGGGAGGATGG - Intronic
1055573537 9:77641040-77641062 ATTTGCATGGGAAGGAAGGAAGG + Intronic
1055592518 9:77832435-77832457 ACTTGGAAGAGGATGGAGGAAGG + Intronic
1056009635 9:82313694-82313716 ATGTGCATAAGGAGGGAGCAGGG + Intergenic
1058750326 9:108032996-108033018 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1058750351 9:108033188-108033210 GTTTTGATGAGGATGGAGAAGGG - Intergenic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059425990 9:114221237-114221259 ATTGGGATGAGGAGATAGGTGGG + Intronic
1059606604 9:115842086-115842108 CTTTGGATTGGGAAGGAGGACGG + Intergenic
1059921235 9:119162223-119162245 AGTTTGCTGAGAAGGGAGGAGGG + Intronic
1060345677 9:122813554-122813576 AGTTGACTGAGGTGGGAGGATGG + Intronic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060676576 9:125520740-125520762 CTTTGGAGGAAGAGGTAGGATGG - Intronic
1060683005 9:125582500-125582522 GTTTGGATGAGGGTGGAGGGTGG - Intronic
1060859747 9:126944577-126944599 AATTGGGTGGGGAGGGAGGGTGG + Intronic
1060976856 9:127770179-127770201 ATGGGGATGAAGAGGAAGGAGGG - Intronic
1061580819 9:131534786-131534808 GCTTGAAGGAGGAGGGAGGAGGG - Intergenic
1061692922 9:132348821-132348843 AGGAGGATGAGGTGGGAGGATGG + Intronic
1061787257 9:133037252-133037274 ATTTTGCTGAGGAGGGTGTAAGG + Intronic
1061865788 9:133491156-133491178 ACTTGGAGGAGGAGGGAGGGAGG + Intergenic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1186518900 X:10188156-10188178 CTTTGGCTGAGGCAGGAGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187456583 X:19446620-19446642 AGATGGCTGAGGAGGGAGGTTGG - Intronic
1187531774 X:20103581-20103603 ATTAGGATCAGGAATGAGGAAGG - Intronic
1187637630 X:21249324-21249346 ACAGGGATGAGGAGGGAGGGAGG + Intergenic
1187847056 X:23550715-23550737 ACCAGGATGAGGAGGGAGGGGGG - Intergenic
1189469619 X:41303585-41303607 AATTGGATGGGGAGGCTGGAGGG - Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1189814099 X:44807492-44807514 AGGAGGATGAGGTGGGAGGATGG - Intergenic
1190280862 X:48928921-48928943 GTTTGCAGGAAGAGGGAGGAAGG + Intronic
1190916676 X:54816398-54816420 ATTTGAATGAGGAGAGAGAGGGG + Intergenic
1191047187 X:56151049-56151071 ATATGGAGCAGGAGGGAGTATGG + Intergenic
1192314087 X:70038636-70038658 ATTTGGCTCAGGATGGATGAAGG - Exonic
1192430893 X:71110878-71110900 ATTGGTATGAGAAGGGACGAGGG - Exonic
1192605754 X:72515478-72515500 ATTTGCATGTTGAGGGAGGAAGG - Intronic
1193923000 X:87451997-87452019 ATTGGGATGACGAGGCAGGCAGG - Intergenic
1194267720 X:91776311-91776333 TTTTGGATGAGGTGTCAGGAAGG - Intergenic
1194966441 X:100293752-100293774 ATTTGGATAGGGAAGAAGGATGG + Exonic
1194972636 X:100360967-100360989 AGGGGGATGAGGAGGGATGAGGG + Intronic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1196814355 X:119653264-119653286 ATTGGGATGAGGAGAGAGAAAGG - Intronic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1198558867 X:137826474-137826496 ATTTGGCTGGAGAGGGAAGAAGG - Intergenic
1198863920 X:141100125-141100147 ATTTGGGAGAGAAGGGAGTACGG + Intergenic
1198898769 X:141487290-141487312 ATTTGGGAGAGAAGGGAGTACGG - Intergenic
1199878199 X:151951903-151951925 ATTTGGATGAGGAGAGACATAGG + Intergenic
1200135716 X:153873667-153873689 AATTGGATTAGGAGGGAAGCAGG - Intronic
1200584930 Y:4997236-4997258 TTTTGGATGAGGTGTCAGGAAGG - Intergenic
1201559457 Y:15300734-15300756 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic