ID: 983522498

View in Genome Browser
Species Human (GRCh38)
Location 4:168724768-168724790
Sequence CTTCACATACAGAGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983522498_983522508 27 Left 983522498 4:168724768-168724790 CCTTCCAACCTCTGTATGTGAAG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 983522508 4:168724818-168724840 TCTTGCCCAAGGCTGTCATGAGG 0: 1
1: 0
2: 2
3: 22
4: 184
983522498_983522504 0 Left 983522498 4:168724768-168724790 CCTTCCAACCTCTGTATGTGAAG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 983522504 4:168724791-168724813 GTTTCCTGGTAGGATGATACTGG 0: 1
1: 0
2: 1
3: 12
4: 146
983522498_983522503 -10 Left 983522498 4:168724768-168724790 CCTTCCAACCTCTGTATGTGAAG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 983522503 4:168724781-168724803 GTATGTGAAGGTTTCCTGGTAGG No data
983522498_983522506 16 Left 983522498 4:168724768-168724790 CCTTCCAACCTCTGTATGTGAAG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 983522506 4:168724807-168724829 ATACTGGCTCCTCTTGCCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983522498 Original CRISPR CTTCACATACAGAGGTTGGA AGG (reversed) Intronic
902995534 1:20222096-20222118 CTTCACATACAAAAGAAGGAAGG + Intergenic
903266330 1:22160242-22160264 CTTCACAAACTGAGCGTGGAGGG - Intergenic
903562224 1:24236553-24236575 CTTCACATTCCTAGGGTGGAGGG + Intergenic
906493683 1:46287554-46287576 CTTCTCAGGCAGAGGGTGGAAGG - Intronic
911971395 1:104442213-104442235 CATCACAGAAAGAAGTTGGAAGG + Intergenic
914092200 1:144511663-144511685 TTTCATATACATAGGTTGAATGG + Intergenic
918368722 1:183837315-183837337 CTTTACAGACAGAGATTGGTTGG + Intronic
921250314 1:213291253-213291275 CCTCACACAAAGAAGTTGGAAGG - Intergenic
1064052376 10:12069371-12069393 CCTCAGTTACAGAGGATGGACGG - Intronic
1064293504 10:14056551-14056573 TTTCAGTTACAGAGGGTGGAGGG - Intronic
1066702103 10:38141247-38141269 TTTAACATATAGAGGATGGAAGG + Intergenic
1068708675 10:60106935-60106957 ATTCTCCTACAGAGGTTGTATGG + Intronic
1070667233 10:78353872-78353894 TTTCACATCCAGAGGTTTGGAGG - Intergenic
1071996758 10:91156727-91156749 CTTCCCAAAGAGAGGTAGGAAGG - Intergenic
1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG + Intergenic
1076250917 10:128983180-128983202 TTTCAGATACAGAGGCTGGAGGG - Intergenic
1076809932 10:132881229-132881251 TTTCACAAGCAGAGGTGGGAAGG + Intronic
1078154558 11:8788150-8788172 CTTCACTTACAGGGTTTGGATGG - Intronic
1083562077 11:63681200-63681222 ATTCACATAAAGAGGCAGGAGGG + Intergenic
1084702048 11:70793281-70793303 CTTCACATACACAGGTTCCATGG + Intronic
1085728362 11:78975021-78975043 CTTCACACAGAGAGGTTGCCTGG - Intronic
1085949552 11:81313204-81313226 GTTCACAGACAGAGGATGGTTGG + Intergenic
1087205469 11:95389343-95389365 TTTCATGAACAGAGGTTGGAGGG - Intergenic
1087677861 11:101183153-101183175 CTGCACATACAAAAGTTGTAGGG - Intergenic
1089015952 11:115165485-115165507 CTTCACAAAAAGAGGTTCTAGGG - Intergenic
1090109763 11:123894265-123894287 CTTCACTTAGAGAGGTAGAAGGG - Intergenic
1090671657 11:128951108-128951130 CTAAACATACAAAGGTTGGCCGG + Intergenic
1090892049 11:130932411-130932433 CTCCTCATACAAAGGTGGGAGGG + Intergenic
1091846185 12:3657841-3657863 CATCACATCCTGGGGTTGGAAGG + Intronic
1091898634 12:4124583-4124605 CTTCTCATACAAGGGTAGGATGG + Intergenic
1092157742 12:6295351-6295373 CTTTACAAACAGAGGTTGCCTGG + Intergenic
1094439324 12:30457270-30457292 CTACACATACAGGGCTGGGAGGG - Intergenic
1095737273 12:45571166-45571188 TTTCACATACAGAGGATGTCTGG - Intergenic
1101800866 12:108020973-108020995 GTACACATACAGAGGATGGGTGG + Intergenic
1103027670 12:117587085-117587107 CTTCCCAGACAGAGGTAGGTAGG - Intronic
1107712741 13:43166748-43166770 CTGAAAATACAGAGGATGGATGG + Intergenic
1112517498 13:100067295-100067317 CCTCAGAGACAGAGGTTGCAGGG + Intergenic
1112585656 13:100716394-100716416 CTTCAGACACAGACCTTGGAGGG - Intergenic
1117529799 14:56649026-56649048 CTTCAAATCCAGAGAATGGAGGG - Exonic
1119656433 14:76420712-76420734 CAAAACACACAGAGGTTGGAGGG + Intronic
1121562180 14:94884082-94884104 CTCCGCAGACAGAGGTTGGGGGG + Intergenic
1122878657 14:104680155-104680177 CTGCACACACTGAGGTGGGAGGG - Intergenic
1123475384 15:20588216-20588238 CTTCACTTACACAGAGTGGAAGG + Intergenic
1123642627 15:22412149-22412171 CTTCACTTACACAGAGTGGAAGG - Intergenic
1124590715 15:31050654-31050676 GTGCACATACAGAGGTGGGAGGG - Intronic
1126387360 15:48107787-48107809 CTTGACACACAGGTGTTGGAAGG + Intergenic
1126934968 15:53696647-53696669 CTTTACTTACAAAGGTTGAATGG - Intronic
1128457194 15:67838105-67838127 CTACAAGCACAGAGGTTGGAAGG + Intergenic
1128521652 15:68379181-68379203 CTGCTCATGCAGAGGTGGGAAGG - Intronic
1129315375 15:74739906-74739928 CTTCACAGACAGGGTCTGGAGGG + Intergenic
1136392685 16:29975179-29975201 CATCACAGCAAGAGGTTGGAAGG - Intronic
1138207308 16:55134328-55134350 CTTCAGATACAGAGATTGTCTGG + Intergenic
1138686399 16:58729828-58729850 CTTAAAAGACAGAGGCTGGAGGG - Intronic
1142163081 16:88569481-88569503 CTTCACATACAAATGTTAGGGGG + Intergenic
1142516805 17:436812-436834 CTGCTCACACAGATGTTGGAAGG - Intergenic
1143017142 17:3896889-3896911 GTTCACATACACAGTGTGGAAGG + Exonic
1144033821 17:11347059-11347081 ATGAACATACAGAGTTTGGATGG + Intronic
1146174055 17:30653544-30653566 CATCACATTCACAGGTTGCAGGG - Intergenic
1149378324 17:56068016-56068038 CTTCACATAGAGAGGTCTGCAGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152265948 17:79294887-79294909 CTTCAAATAAAGAGTTGGGAGGG - Intronic
1152325594 17:79634089-79634111 CATCCCATCCAGAGGTGGGAGGG + Intergenic
1152613267 17:81326030-81326052 CTTCTCATTCAAAGGTTGGATGG - Intronic
1153842534 18:9019857-9019879 CTTCAGAGACTGAGGTAGGAGGG + Intergenic
1155696283 18:28690768-28690790 CTTCACCTTCAGATGTTAGAGGG - Intergenic
1158094559 18:53756032-53756054 CATCACAGACTGAGGTTAGAGGG - Intergenic
1160326304 18:77952225-77952247 CTCCATATACAGAGGCTGGTGGG - Intergenic
1162988356 19:14286486-14286508 CATCACATTCACAGGTTGCAGGG + Intergenic
1165932988 19:39372406-39372428 CTTCACACACTGAGGTCTGAGGG - Intronic
1168379318 19:55906800-55906822 CATCCCTTTCAGAGGTTGGATGG + Intronic
925603757 2:5636666-5636688 ATTCACATACATATGTTGAATGG - Intergenic
927474021 2:23398420-23398442 ATTCACAGACAGAGGTAGAATGG + Intronic
929531837 2:42757487-42757509 CTTCACAAACACAGGCTGGAGGG - Intergenic
930356836 2:50331501-50331523 CTTCACAGACATAGTTTTGATGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
942174599 2:173320044-173320066 CTGCACATGCACAGGTTGGGGGG + Intergenic
944156471 2:196612480-196612502 CTTCATATTCAGAGGTGGTAAGG - Intergenic
946724831 2:222652073-222652095 CCTAACATACAGTGGTGGGATGG - Intronic
946799355 2:223394022-223394044 ATTCACATACAGATTTTGCATGG + Intergenic
1172517844 20:35547804-35547826 CTTCACATAGAGAGGTTACATGG - Intronic
1173098807 20:40064646-40064668 CTTCACCTACAGTGGTAGCATGG + Intergenic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1177101319 21:16899815-16899837 CTTCTTGTACAAAGGTTGGAAGG - Intergenic
1181627158 22:24129839-24129861 GTTCACAAAGAGGGGTTGGAGGG + Intronic
1185169747 22:49285892-49285914 CTTTACATCCTGAGGCTGGAAGG + Intergenic
952513021 3:34076190-34076212 CTTCCCATACAGTGGGTGGCCGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955137706 3:56236376-56236398 CTTCACATTCAGGGCCTGGATGG - Intronic
956982891 3:74660430-74660452 CTCCACATGCAGAGGTTTGTAGG - Intergenic
957228401 3:77478536-77478558 CTTCACATACAAATGTTGCGTGG - Intronic
958812259 3:98874781-98874803 CCTCACATGACGAGGTTGGAGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
969142021 4:5084105-5084127 ATTTAAATACAGAGATTGGAGGG - Intronic
970010910 4:11458122-11458144 CTTCAAATACAGATTTTGGGAGG + Intergenic
970827150 4:20289806-20289828 TGTGACCTACAGAGGTTGGAGGG + Intronic
971476894 4:27080915-27080937 CTTCACACACAGAGATGAGAAGG - Intergenic
971534712 4:27734711-27734733 CTTCACAAAAAGTGGATGGATGG - Intergenic
975720696 4:77245990-77246012 CTTCCCATCCAGAGGGTGGTGGG + Intronic
975898691 4:79123919-79123941 CAACACACACTGAGGTTGGAGGG - Intergenic
976255369 4:83094885-83094907 TTTCAGATTCAGAGTTTGGATGG + Intronic
981195212 4:141911768-141911790 CTTGACATACAGAGACTGGTGGG - Intergenic
981453498 4:144926971-144926993 CTTCACAGAATGAGTTTGGAAGG + Intergenic
982094488 4:151909586-151909608 AGCCACAGACAGAGGTTGGAAGG - Intergenic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
985129750 4:186727172-186727194 ATTCACATCCAGAAGTTGGAGGG - Intergenic
986092040 5:4519137-4519159 CTTCACATACAGATCCTGGGAGG - Intergenic
986573723 5:9191486-9191508 CTTCACATAAGTAGGTTTGATGG + Intronic
987030607 5:13973328-13973350 ATTCTCATACAGTGGTTAGAGGG - Intergenic
994148804 5:96424257-96424279 CTCCCCATAAAGAGGTTGGGGGG + Intronic
995425656 5:112019488-112019510 TATCACATTCAGAGGTTGCAGGG + Intergenic
996543446 5:124653477-124653499 CTTGAAGTACAGAGTTTGGATGG - Intronic
996732313 5:126727894-126727916 TTAGACAGACAGAGGTTGGATGG - Intergenic
997962246 5:138331503-138331525 CCCCACAGACAGAGGTTGGGAGG - Intronic
998861052 5:146444851-146444873 CTTGACAGGCAGAGGTGGGAGGG - Intergenic
1002025447 5:176393554-176393576 CATCACATACACACCTTGGAGGG - Intronic
1002554098 5:180020774-180020796 CTTCACACACAGAGGCAGAAGGG + Intronic
1002872357 6:1178334-1178356 GTTCAGATACATAGGTGGGATGG + Intergenic
1003252325 6:4441045-4441067 CTTGACATTCAGAGGTTTGTTGG + Intergenic
1004554446 6:16682058-16682080 GTTCAGATACAGATGTTGGCAGG - Intronic
1005390110 6:25324252-25324274 CTTCACTTACAGAGCTGGGGAGG + Intronic
1007114321 6:39332699-39332721 CTTCACATGCAGATGTTGATCGG + Exonic
1008539817 6:52536891-52536913 CTTCTCTAACAGAGGTTTGAAGG + Intronic
1010323237 6:74537911-74537933 CTTCCCAGACAGAGGTGGAAAGG - Intergenic
1012297987 6:97548319-97548341 CTTCACATATAGAAGTAGGGCGG + Intergenic
1014550167 6:122781123-122781145 GTTCACATACAGAAATGGGATGG + Exonic
1018452392 6:163921319-163921341 CTTGTCATGCAGAGGTGGGATGG + Intergenic
1022286889 7:28962076-28962098 CTTCAGCTACAGAGGTATGAAGG + Intergenic
1028830842 7:95324958-95324980 CTTGAAATCCAGATGTTGGAAGG - Intergenic
1031891156 7:127294548-127294570 CTGGCCATACTGAGGTTGGAGGG - Intergenic
1036498518 8:9292792-9292814 CTTCATGTACAGGGGTTGCAGGG - Intergenic
1037512451 8:19597795-19597817 CTTCACAAACAAAGGTTTGAAGG - Intronic
1037623080 8:20584109-20584131 ATTCAGATACTGAGGGTGGAGGG + Intergenic
1039081544 8:33738808-33738830 CATCACACACAGTGTTTGGAAGG - Intergenic
1039848086 8:41340328-41340350 GTTCACATCCAGAAGCTGGAAGG - Intergenic
1039968261 8:42299465-42299487 GGTCACACACAGAGGTTGGCGGG - Intronic
1041696223 8:60739531-60739553 CTCCAAATACAGAGGTCAGATGG - Intronic
1042782975 8:72512117-72512139 CTTAAAATACTGAGGTGGGAGGG - Intergenic
1043124457 8:76372591-76372613 CTTTTCATACAGAGGTAAGAAGG - Intergenic
1043153603 8:76749185-76749207 TATCACATACAGATGGTGGAAGG - Intronic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1045249976 8:100475023-100475045 CCTCACTGACAGAGATTGGAGGG + Intergenic
1046826833 8:118701078-118701100 GGTCACACACAGAGGTAGGATGG - Intergenic
1046834306 8:118782529-118782551 ATTCTGATACAGAGGTTTGAGGG + Intergenic
1050346818 9:4697139-4697161 CTTCACATACAAGGTATGGATGG - Exonic
1052258529 9:26488231-26488253 CTTCACAGACAAAGGCAGGAAGG - Intergenic
1058899530 9:109430334-109430356 CTTCATATACAGGGGTAGGAGGG + Intronic
1062084175 9:134640431-134640453 CTTCACACACAGACGTGGGGAGG - Intergenic
1062181170 9:135192020-135192042 CCCCACACACAGAGGATGGAGGG + Intergenic
1186555562 X:10554708-10554730 CTTCACTTAAGGAGCTTGGAGGG - Intronic
1188852307 X:35146884-35146906 CAACACAAAGAGAGGTTGGAAGG + Intergenic
1189846767 X:45145740-45145762 CTTCACGTACTGAGCATGGATGG + Intergenic
1193212998 X:78829464-78829486 GTTCACATTCAGAGGTTGCCAGG - Intergenic
1195475639 X:105281964-105281986 CTTCATTTACAGAGCTTGAATGG + Intronic
1195575003 X:106439605-106439627 ATTCACAGAAAGAGGGTGGAGGG - Intergenic
1195994355 X:110716835-110716857 CTGCACATGTACAGGTTGGATGG - Intronic
1198509403 X:137334506-137334528 CATCCCATACAGTGGTTAGAAGG + Intergenic
1200987034 Y:9312348-9312370 CTTCACACACACACATTGGAAGG + Intergenic