ID: 983523572

View in Genome Browser
Species Human (GRCh38)
Location 4:168736671-168736693
Sequence CCTGATGTTCAGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983523572_983523583 7 Left 983523572 4:168736671-168736693 CCATCCACCATCTGAACATCAGG 0: 1
1: 0
2: 0
3: 14
4: 243
Right 983523583 4:168736701-168736723 CTGGGTGGAGATGGCTGTGAGGG 0: 1
1: 1
2: 0
3: 51
4: 446
983523572_983523578 -8 Left 983523572 4:168736671-168736693 CCATCCACCATCTGAACATCAGG 0: 1
1: 0
2: 0
3: 14
4: 243
Right 983523578 4:168736686-168736708 ACATCAGGATTCCGCCTGGGTGG No data
983523572_983523582 6 Left 983523572 4:168736671-168736693 CCATCCACCATCTGAACATCAGG 0: 1
1: 0
2: 0
3: 14
4: 243
Right 983523582 4:168736700-168736722 CCTGGGTGGAGATGGCTGTGAGG 0: 1
1: 1
2: 6
3: 61
4: 545
983523572_983523584 20 Left 983523572 4:168736671-168736693 CCATCCACCATCTGAACATCAGG 0: 1
1: 0
2: 0
3: 14
4: 243
Right 983523584 4:168736714-168736736 GCTGTGAGGGAGCTAACAAGCGG 0: 1
1: 0
2: 0
3: 15
4: 146
983523572_983523579 -2 Left 983523572 4:168736671-168736693 CCATCCACCATCTGAACATCAGG 0: 1
1: 0
2: 0
3: 14
4: 243
Right 983523579 4:168736692-168736714 GGATTCCGCCTGGGTGGAGATGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983523572 Original CRISPR CCTGATGTTCAGATGGTGGA TGG (reversed) Intronic
900039903 1:451271-451293 CATAATGGTCAGATAGTGGAGGG + Exonic
900061335 1:686247-686269 CATAATGGTCAGATAGTGGAGGG + Exonic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
905229840 1:36508125-36508147 CTTCATGGTCTGATGGTGGATGG + Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909612210 1:77563372-77563394 CCTGAAGTTCAGATAGTAGTAGG - Intronic
909685437 1:78343158-78343180 CCTGTTGTGGAGTTGGTGGAGGG - Intronic
909853260 1:80496120-80496142 CCTGATGCTAAGATGGGGGTAGG - Intergenic
912748504 1:112266101-112266123 CCAGACAGTCAGATGGTGGAAGG + Intergenic
916059442 1:161088735-161088757 CCTGATGCCCAGAGAGTGGATGG - Intronic
916522202 1:165574049-165574071 CCTGTTGTTCTTATGGTGGAGGG - Intergenic
917680709 1:177363957-177363979 ACTGATGTGCATATAGTGGAAGG - Intergenic
917793761 1:178517083-178517105 GCTCATGTTCAGATGGTGCTGGG + Intronic
918828974 1:189366501-189366523 CCTGAGATTCAGTTGCTGGAGGG - Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
920131535 1:203735858-203735880 CCTGATGGTTTGATGGTGGAAGG + Intronic
920597941 1:207291869-207291891 CCTGATTTTCAGAGGATGTATGG + Intergenic
921618485 1:217299646-217299668 TCTGATATTCAAATGATGGAGGG + Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922910393 1:229210929-229210951 CCATGTGTTGAGATGGTGGAGGG - Intergenic
923473733 1:234314050-234314072 GCTGATGTCCAGAGAGTGGAAGG + Intronic
923644631 1:235805402-235805424 GCTGATGCGCAGATGGTGAATGG + Intronic
1063079468 10:2751774-2751796 CTTGATTTCCAGATGGTGAATGG - Intergenic
1065177907 10:23096155-23096177 CCTGCTTCTCAGATGCTGGAAGG - Intronic
1067364230 10:45610160-45610182 CATCATGTCCACATGGTGGAAGG - Intergenic
1067669229 10:48304581-48304603 ACTGATGTTAAGTTGGTGGTTGG - Intergenic
1067991467 10:51217930-51217952 CCTGAGATTCAGATGAAGGAGGG - Intronic
1068843550 10:61644037-61644059 CTTGATGTTAATATGGTGGGGGG + Intergenic
1068954666 10:62812034-62812056 ACTGAAGTTCAGATAATGGATGG - Exonic
1069441078 10:68428570-68428592 CCAGATTTTCAGAGGGTGAATGG + Intronic
1070608134 10:77914043-77914065 GCTCATTTTCAGATGGTGCAGGG - Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1074125469 10:110525638-110525660 CAGGATGTTCAGGTGGTGGGAGG + Intergenic
1076328404 10:129646150-129646172 CCCAGTGTTCAGATGGCGGAAGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1083674946 11:64319875-64319897 CCTGATCTTCAGAAGGGGAAGGG - Intronic
1084238432 11:67803208-67803230 CCTGACCTTCAGATGTTGCAGGG + Intergenic
1086243618 11:84724899-84724921 TCTAATGTTCTCATGGTGGAAGG + Intronic
1087657303 11:100939837-100939859 CCTGAACTTCAGATGGAGGCGGG + Intronic
1088790336 11:113220054-113220076 TCTGATGTTCAGATGGAAAAAGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1093351319 12:18106165-18106187 CTAGATCTTCACATGGTGGAAGG - Intronic
1093836534 12:23837059-23837081 CCTGATGCTTAGATGATGTAAGG + Intronic
1093858561 12:24135666-24135688 CTGGATGTTCAGAGGATGGAGGG + Intergenic
1098702401 12:73645619-73645641 CCTGATGATCAGAGGGTGTGTGG + Intergenic
1099091231 12:78311809-78311831 CCTTATGTTCACATGATGGAAGG - Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1100695696 12:97090344-97090366 CCTCATCCTCAAATGGTGGAAGG - Intergenic
1102678106 12:114672171-114672193 CATGGTGTTCAGATTGAGGAAGG + Exonic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103273384 12:119691467-119691489 GCAGATGCTCAGAAGGTGGATGG + Intronic
1104526796 12:129531695-129531717 GCTGAGGTTCAGATAGGGGAAGG + Intronic
1105508787 13:21034214-21034236 CCTGAGGCTCAGAAGGTGCATGG + Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1112799459 13:103094083-103094105 CATGATGTTCTCATGGTGGTGGG - Intergenic
1113184980 13:107677858-107677880 CCTGTAATTCAGATGGTTGAAGG + Intronic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1114032156 14:18587218-18587240 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1114479453 14:23023261-23023283 CCTGGTGTGCAGATGCTGGAAGG + Intronic
1118442095 14:65821441-65821463 CCTGCTGCTCAGGTGGTGCAGGG + Intergenic
1120222259 14:81747522-81747544 GCTGATTTTCAGATGTTGAAAGG + Intergenic
1121043233 14:90767554-90767576 CCTTATCTTCCCATGGTGGAAGG - Intronic
1122470488 14:101962784-101962806 TCTGAGTCTCAGATGGTGGATGG + Intergenic
1202897902 14_GL000194v1_random:20642-20664 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1126032808 15:44516393-44516415 CCTAATGTTCATATTTTGGAAGG + Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1128395564 15:67221949-67221971 CATGAAGTTGAGATGATGGAGGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128780861 15:70357699-70357721 GCTGATGTGCAGATGGGTGATGG + Intergenic
1129239771 15:74244467-74244489 CATGATGGTCAGATTGGGGAAGG + Intronic
1129921236 15:79320851-79320873 CCTGATGTCGAGGTGGTGGCAGG + Intronic
1130833809 15:87629982-87630004 CCGCATTTTCACATGGTGGAAGG + Intergenic
1131114095 15:89783677-89783699 TTTGATGTGCAGATGGTGGTGGG + Intergenic
1131340524 15:91596476-91596498 ACTGGTGTTCTGAGGGTGGAGGG + Intergenic
1132442004 15:101876348-101876370 CATAATGGTCAGATAGTGGAGGG - Intergenic
1137280775 16:46974513-46974535 CCAGAGGTTTAGATGGTGTAAGG + Intergenic
1137449747 16:48560620-48560642 CCTTAGGGTCGGATGGTGGAGGG - Intronic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1139092542 16:63666074-63666096 CCTCATGCTCAGATGGTGCCTGG + Intergenic
1141043460 16:80692288-80692310 CCTGATTTTTGGATGGGGGAGGG - Intronic
1145303089 17:21654239-21654261 CCTGATGTTCAGTTGGCGACTGG - Intergenic
1145346949 17:22047602-22047624 CCTGATGTTCAGTTGGCGACTGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1148340698 17:46871892-46871914 CCAGGTGGTCAGATGGTTGAAGG + Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1151566983 17:74904228-74904250 ACTGAGGTTCAGGTGGGGGATGG - Intergenic
1155032825 18:21999129-21999151 CCTGAGGCTCAGCTGGTGTAGGG + Intergenic
1155486935 18:26354465-26354487 CCTTATCATCAGATGTTGGATGG + Intronic
1158033472 18:52995726-52995748 CCTTATGTTCAGATGTTAGCTGG - Intronic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158504671 18:58035994-58036016 TGTGATGTTCTCATGGTGGAGGG + Intergenic
1159010215 18:63051843-63051865 CCAGATGTTCCCATGGTGAAGGG - Intergenic
1159211869 18:65333483-65333505 GATGTTATTCAGATGGTGGAAGG - Intergenic
1159375988 18:67593895-67593917 TCTGATGCTCAAATGGAGGAAGG - Intergenic
1160642929 19:156810-156832 CATAATGGTCAGATAGTGGAGGG + Intergenic
1160833217 19:1112848-1112870 CCTGAGGTTCACGTGGTCGATGG + Exonic
1162583394 19:11544443-11544465 ACTGAGAGTCAGATGGTGGAGGG + Intronic
1164767597 19:30783764-30783786 GCTGAAGTTCAGAGGGAGGAAGG + Intergenic
1165135472 19:33665757-33665779 CCTGATGGGTAGAGGGTGGAGGG + Intronic
1166210401 19:41303208-41303230 GCTCATGGTCAGATGGGGGAAGG - Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
929453415 2:42050832-42050854 CCTGATGGTCAGAAGATGAATGG - Intronic
931109700 2:59097500-59097522 ACTGTTGGTCTGATGGTGGAAGG - Intergenic
932163399 2:69483467-69483489 CCAAATGTTCAGTTGGTGAATGG - Intronic
934939881 2:98493027-98493049 CCTGATGGGCAGCTGGTGGAGGG - Intronic
935208218 2:100915048-100915070 CCTAATGCTCAGATTGTGCAAGG + Intronic
937941255 2:127287857-127287879 CTTGATCTTCAAATGGTGGATGG - Intronic
938491540 2:131763758-131763780 CCTGATGTTCAGATAAGGGCTGG - Intronic
938496027 2:131798584-131798606 CCTGATGTTCAGATAAGGGCTGG + Intronic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
945340261 2:208644275-208644297 CCTGCTCTTCAGGTGGTGGGTGG + Intronic
948322017 2:237077606-237077628 CCTGATGTTAAGATGGAGTAAGG - Intergenic
948641037 2:239376102-239376124 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641045 2:239376146-239376168 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641060 2:239376231-239376253 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641068 2:239376275-239376297 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641076 2:239376319-239376341 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948981164 2:241495634-241495656 ACTGCTGTTCAGATAGGGGACGG - Exonic
1170567393 20:17614880-17614902 CCTGATGGTCAGAAGGTTGACGG + Exonic
1172742998 20:37183997-37184019 CCTGCTCTTCAACTGGTGGAAGG - Intronic
1173993392 20:47319894-47319916 CCTCATGTACACATGTTGGAGGG - Intronic
1175353907 20:58346769-58346791 GCTGATGTTCAGATATTGGTTGG + Intronic
1176617584 21:9036631-9036653 CCTGCTGTTCAGCTGGGGTATGG - Intergenic
1176708651 21:10132607-10132629 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1176708883 21:10133796-10133818 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1177086263 21:16709066-16709088 CACGATGTTAACATGGTGGAAGG + Intergenic
1180456270 22:15514275-15514297 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1181838523 22:25631961-25631983 CCAAATGTTCAGTTGGTGGATGG - Intronic
1182904851 22:33926572-33926594 CCTGAAGTTCACATGTTGAAAGG + Intergenic
1184726052 22:46347245-46347267 CCGGAAGTTCAGATGTTGGAGGG + Intronic
1185309674 22:50147138-50147160 GCTGATGTTCAGGTAGTGGGAGG + Intronic
955003068 3:54945179-54945201 GCTAATGTTCAGATGAGGGAGGG - Intronic
958904479 3:99927005-99927027 CAGGAGGTTCAGATGGTGAAGGG - Intronic
959773669 3:110131093-110131115 ACTGATGATCAGATGGTTGTCGG - Intergenic
960361314 3:116715220-116715242 CAAGATGTTCAGTTGGTGAATGG - Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961269831 3:125680455-125680477 CCAGATGTTCAGATGGGGACTGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
963850001 3:150201598-150201620 GGTGGTGTTCAGCTGGTGGATGG - Intergenic
964655951 3:159066379-159066401 CCTGATCATAACATGGTGGAAGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967344773 3:188442505-188442527 TCTGATATTTAGATAGTGGATGG + Intronic
967691023 3:192473858-192473880 CATGATATTCTCATGGTGGAGGG - Intronic
968014458 3:195316812-195316834 CCAGATGTTTACATGGTAGATGG - Intronic
969093575 4:4715632-4715654 CCTGATGCTCACGAGGTGGAAGG + Intergenic
969446729 4:7249151-7249173 GCTTGTGTTCAGATGGTGGCTGG + Intronic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
974543463 4:63269435-63269457 CATGATCTTCTTATGGTGGATGG - Intergenic
974583415 4:63836867-63836889 CCCTATGGTCAGGTGGTGGATGG + Intergenic
976010223 4:80477588-80477610 CTTGAAGTTGAGATTGTGGAAGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982446559 4:155497495-155497517 CCTTGTGTCCACATGGTGGAAGG + Intergenic
982518777 4:156386868-156386890 CCTGCTGTTGAGATAGAGGAAGG - Intergenic
982545884 4:156732367-156732389 ACTTATGTTCAAATTGTGGATGG - Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983876066 4:172875599-172875621 CCTGCTGTTCAGTAGGTGGATGG - Intronic
984854622 4:184184072-184184094 CATGATGTCCAGTTGGTGCATGG - Intronic
985641647 5:1066110-1066132 CCTGAAGGTCAGAGGGTGGGAGG - Intronic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
988529734 5:32017024-32017046 ACAGATGTGCAGATGGGGGATGG + Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
989474382 5:41857423-41857445 TCTGAGGTCCAGATGTTGGAGGG - Intronic
991214322 5:64144759-64144781 GCTGGTGATCAGAGGGTGGAAGG - Intergenic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
996493749 5:124129560-124129582 CCTGCTGTTCAAATAGGGGATGG - Intergenic
998244431 5:140485705-140485727 ACTGATCTTGAGAAGGTGGAGGG - Exonic
998937268 5:147242376-147242398 CCCCATGTTCTGATGATGGAAGG + Intronic
999109914 5:149110196-149110218 TGTGATGCGCAGATGGTGGAAGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1001536914 5:172504454-172504476 CCTGAAGCTCAGAAGCTGGATGG + Intergenic
1002733944 5:181367672-181367694 CATAATGGTCAGATAGTGGAGGG - Exonic
1002750599 6:106450-106472 CATAATGGTCAGATAGTGGAGGG + Intergenic
1003440614 6:6138065-6138087 GGTGGTGTTCAGGTGGTGGATGG + Intergenic
1006836414 6:37001668-37001690 CCTGCAGCTCAGATGGGGGAAGG + Intergenic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1012487627 6:99739759-99739781 CTTGATGATCATATGGTGCATGG - Intergenic
1013295262 6:108753190-108753212 CTTGATGTACAGGTGGTGGGAGG + Intergenic
1013970502 6:116012300-116012322 GCTTGTGTCCAGATGGTGGAAGG - Intronic
1016298370 6:142600977-142600999 CCTGAAGTTCAGGTAGAGGAAGG - Intergenic
1019238191 6:170639990-170640012 CATAATGGTCAGATAGTGGAGGG - Intergenic
1019696129 7:2447040-2447062 CCTGATGTGCTGAGGGTGCAGGG + Intergenic
1021003521 7:15363684-15363706 TTTGATGATGAGATGGTGGAGGG - Intronic
1021925740 7:25532025-25532047 CCTGATCTCCAGTTGGTGGTGGG - Intergenic
1024907097 7:54398025-54398047 GCTTATGTTGAGATGGAGGAAGG - Intergenic
1024981190 7:55158961-55158983 ACTGATGTTCAGGTGTTGGATGG - Intronic
1029692577 7:102192016-102192038 CCAGATGTGCACATGGTGGTGGG - Intronic
1030787340 7:113678542-113678564 TCTGATTTTCAGGTGGTGGGAGG + Intergenic
1031453689 7:121953830-121953852 CATTAGGTTCAGATGGTGGGTGG - Intronic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1035509576 8:166617-166639 CATAATGGTCAGATAGTGGAGGG + Exonic
1035552479 8:539701-539723 CCTGATGTTCTGCTGGAGGGCGG - Intronic
1035604279 8:919527-919549 CCTGATGTTAACTGGGTGGATGG - Intergenic
1036264061 8:7261056-7261078 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036265357 8:7268678-7268700 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036266658 8:7276300-7276322 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036267964 8:7283922-7283944 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036269268 8:7291544-7291566 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036297325 8:7547880-7547902 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1036316101 8:7719595-7719617 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036317410 8:7727243-7727265 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036318718 8:7734891-7734913 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036320025 8:7742538-7742560 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036321334 8:7750186-7750208 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036322643 8:7757834-7757856 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036323949 8:7765483-7765505 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036325254 8:7773139-7773161 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036353391 8:8026470-8026492 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1037096592 8:14993682-14993704 CCTGAGGTAGAGATTGTGGATGG + Intronic
1038241575 8:25813331-25813353 ACTGATGTTTAGATGGTCTAAGG + Intergenic
1038904476 8:31883686-31883708 CCTGCTGTTCAGTTGGTTGGAGG + Intronic
1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG + Intronic
1040410041 8:47144807-47144829 CCTGATGTCCAGAAGTTTGATGG - Intergenic
1040727341 8:50398278-50398300 TATGATGGGCAGATGGTGGACGG - Intronic
1040776716 8:51052734-51052756 CATGATGTTAAGATAATGGAAGG - Intergenic
1041362284 8:57066503-57066525 CTTGATGTTCTGGTGGTGAATGG + Intergenic
1044781525 8:95748555-95748577 CATGATGATCAGATATTGGAAGG + Intergenic
1045230945 8:100306692-100306714 CCTGTATTTCAGATGGTGGTAGG - Intronic
1047402723 8:124559632-124559654 CCTGATGTTCAGCTGGGGCAGGG + Intronic
1048127884 8:131657204-131657226 GATGATGTTCAGATTGTGGCTGG + Intergenic
1048732827 8:137462812-137462834 ACTGAGGATCGGATGGTGGAAGG - Intergenic
1050840232 9:10139740-10139762 CCTGAAGATCAGATGGTTGTAGG - Intronic
1051806876 9:21004530-21004552 CTATATGTTCACATGGTGGAGGG - Exonic
1053525762 9:38829200-38829222 CCTGATTTTAAGATGATGGCTGG - Intergenic
1053645621 9:40118103-40118125 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1053645860 9:40119311-40119333 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1053759858 9:41344225-41344247 CCTGATGTTCAGCTGGGGCCTGG + Intergenic
1053760089 9:41345406-41345428 CCTGATGTTCAGATAAGGGCTGG + Intergenic
1054197993 9:62053636-62053658 CCTGATTTTAAGATGATGGCTGG - Intergenic
1054326636 9:63716004-63716026 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1054326869 9:63717212-63717234 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1054538711 9:66256661-66256683 CCTGATGTTCAGCTGGGGCCTGG + Intergenic
1054538952 9:66257869-66257891 CCTGATGTTCAGATAAGGGCTGG + Intergenic
1054640362 9:67534735-67534757 CCTGATTTTAAGATGATGGCTGG + Intergenic
1057103465 9:92387628-92387650 CTTGATGCCCACATGGTGGAAGG - Intronic
1058458116 9:105157327-105157349 TCTGGTGTCCAGATGATGGAGGG - Intergenic
1058531573 9:105911003-105911025 CTTGATGTTTACATGGTGAATGG + Intergenic
1060066014 9:120501741-120501763 CATGGTCTTCAGCTGGTGGATGG - Intronic
1060222620 9:121772731-121772753 CCTGATCTTCAGATGGCCAACGG + Exonic
1060314029 9:122491726-122491748 CAGGATGTACACATGGTGGATGG + Intergenic
1061533149 9:131230361-131230383 CCTGGTGTTCCAATGGGGGATGG + Intronic
1061860057 9:133463516-133463538 CGCAATGTTCAGAGGGTGGATGG - Exonic
1062261489 9:135665299-135665321 CCTGAAGTTCTGGAGGTGGAAGG - Exonic
1062758397 9:138320282-138320304 CATAATGGTCAGATAGTGGAGGG - Intergenic
1202793412 9_KI270719v1_random:101576-101598 CCTGATGTTCAGATAAGGGCTGG - Intergenic
1202793644 9_KI270719v1_random:102766-102788 CCTGATGTTCAGCTGGGGCCTGG - Intergenic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1189526042 X:41823157-41823179 CCTGATTTTCAGCAGGTGGGAGG - Intronic
1191210456 X:57879327-57879349 GCTGAAGTTCAGATGGTTGTTGG - Intergenic
1196023567 X:111015771-111015793 CCTGATTTAAAAATGGTGGAAGG - Intronic
1197727030 X:129783191-129783213 CCTGATGATGGGATGGTGGGTGG - Intronic
1200962290 Y:9006651-9006673 CATGATGTCTAGATGTTGGAAGG + Intergenic
1200981617 Y:9267861-9267883 CATGATGTCTAGATGTTGGAAGG - Intergenic