ID: 983523985

View in Genome Browser
Species Human (GRCh38)
Location 4:168741570-168741592
Sequence AGCTACTCGGGACAGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55790
Summary {0: 1, 1: 17, 2: 574, 3: 10259, 4: 44939}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983523978_983523985 6 Left 983523978 4:168741541-168741563 CCGGCATGGTGGCTCATGCCTGT 0: 260
1: 1276
2: 3160
3: 5872
4: 7708
Right 983523985 4:168741570-168741592 AGCTACTCGGGACAGTGAGGTGG 0: 1
1: 17
2: 574
3: 10259
4: 44939

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983523985 Original CRISPR AGCTACTCGGGACAGTGAGG TGG Intronic
Too many off-targets to display for this crispr