ID: 983527086

View in Genome Browser
Species Human (GRCh38)
Location 4:168770427-168770449
Sequence TAAGGACCTGTTAAATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983527086_983527093 17 Left 983527086 4:168770427-168770449 CCTGCTCATTTAACAGGTCCTTA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 983527093 4:168770467-168770489 CACAAGTGCTGGCGATCTTCAGG 0: 1
1: 0
2: 0
3: 2
4: 59
983527086_983527091 6 Left 983527086 4:168770427-168770449 CCTGCTCATTTAACAGGTCCTTA 0: 1
1: 0
2: 0
3: 8
4: 105
Right 983527091 4:168770456-168770478 TGGGCCTGATACACAAGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983527086 Original CRISPR TAAGGACCTGTTAAATGAGC AGG (reversed) Intronic
901926370 1:12568617-12568639 TAAGCAGCTGTTAAAAGGGCAGG + Intronic
904216677 1:28925882-28925904 TTAGTACATGTTAAGTGAGCAGG + Intronic
905513238 1:38541079-38541101 TTTGAACCTGTTAAATTAGCTGG - Intergenic
907123676 1:52030626-52030648 TATGGAGCTGTTAAAAGAGAGGG - Intronic
907765724 1:57408781-57408803 AAAGGACCTGTTCATAGAGCGGG - Intronic
911552030 1:99294261-99294283 TAATGTCCTGTTTAATGAGAGGG + Intronic
913020311 1:114782730-114782752 TAAGGACCTTTTCAAGGAGCTGG + Intergenic
921152952 1:212416069-212416091 TAAGCAACTGTTAAATGAAATGG - Intergenic
1066293186 10:34032393-34032415 TGAGAACCTGTTAACTAAGCAGG - Intergenic
1067422879 10:46172750-46172772 TAAAGACCAGAAAAATGAGCTGG - Intergenic
1068547028 10:58359119-58359141 TAAGAAAGTGATAAATGAGCTGG - Intronic
1069859186 10:71459901-71459923 TAAGGACCAGCTACAAGAGCTGG - Intronic
1071815852 10:89232265-89232287 TAAAGAGCTGTGACATGAGCAGG - Intronic
1079786110 11:24674786-24674808 TATGGAATTGTTAAATGCGCAGG - Intronic
1080026154 11:27617160-27617182 TAAGGAGATGCTAAATTAGCAGG - Intergenic
1080130650 11:28790966-28790988 TAAGAACTTGTTTTATGAGCTGG + Intergenic
1084405814 11:68972419-68972441 CAATGACCTGTTGAATGTGCTGG + Intergenic
1088178368 11:107080557-107080579 TAAGGACCTGTTTATTAAGAGGG - Intergenic
1090316611 11:125796431-125796453 AAAGGAGCTGTTAAAAGAGGTGG - Intergenic
1091551641 12:1539463-1539485 TGAGGACCTGTTTAATCAGCAGG - Intronic
1092911381 12:13147995-13148017 AAAGGTCCTGATAGATGAGCTGG - Intergenic
1094551041 12:31451699-31451721 TAATGACCAGTTCAATGAGCTGG + Intronic
1099044644 12:77701061-77701083 TATTGGCCTGTTAAATGAGTTGG + Intergenic
1101198395 12:102408948-102408970 TGAGAAGGTGTTAAATGAGCAGG - Intronic
1103664789 12:122554877-122554899 TAAAAACCTGTTTCATGAGCTGG + Intronic
1106780207 13:33051611-33051633 CAAGGACATGATAAATGACCTGG - Intronic
1107465386 13:40645262-40645284 ATAGGACCTTTAAAATGAGCAGG - Intronic
1107811739 13:44206958-44206980 TCAGGACCTGTGAAATGACATGG - Intergenic
1109010671 13:56938145-56938167 TAAGGACATTTTCAAAGAGCCGG - Intergenic
1111939246 13:94592110-94592132 TAAAGACCTTTTAAAAGATCAGG - Intronic
1114739831 14:25084201-25084223 TGAGGACGTGTGAAATGAGCTGG + Intergenic
1114980304 14:28156445-28156467 TAAGGACTTGTTAATTGTCCTGG + Intergenic
1116573958 14:46549995-46550017 TAAGGAACTGTTAAATGCTGAGG + Intergenic
1118566128 14:67142910-67142932 TGAGGCCCTGAGAAATGAGCTGG - Intronic
1121191782 14:92037384-92037406 TAAGTACCTGACATATGAGCAGG + Intronic
1121557469 14:94849236-94849258 AAAGGACCTATCAGATGAGCTGG - Intergenic
1121837191 14:97102559-97102581 TCAGGACCGGTTAGATTAGCAGG + Intergenic
1123099315 14:105785476-105785498 GAAGCACCTGTTAAATGGACTGG - Intergenic
1123988142 15:25663106-25663128 TGAGGACCAGTGAAATAAGCTGG - Intergenic
1126047975 15:44662276-44662298 TCAGGAGCTGTTAGAGGAGCTGG + Intronic
1126065032 15:44819974-44819996 TCTTGACCTGTTAAATGAGTAGG - Intergenic
1126094801 15:45080615-45080637 TCTTGACCTGTTAAATGAGTAGG + Intergenic
1136038790 16:27561546-27561568 AAAGGACATGTTAAATCAGAGGG - Intronic
1146593024 17:34145119-34145141 GAAGGGGCTGTTAAATGACCTGG - Intronic
1147489204 17:40848528-40848550 TAAGGAACAGTTGAATGAACTGG - Intergenic
1154930388 18:20988639-20988661 GAACCACCTGTTAAATGAGCTGG - Intronic
1155363697 18:25029524-25029546 GAAGGACCTGTTAGAAGAACAGG + Intergenic
1158602877 18:58870198-58870220 TAAGCATCTGTTAAATGACAAGG - Intronic
1166441971 19:42823241-42823263 AAAGGACCGGTTAAAGGAGAGGG + Intronic
928132622 2:28663912-28663934 TAAGTATCTGTTGAATGAACAGG - Intergenic
928938470 2:36704444-36704466 TAGCGGCCTGTTAAATGAGACGG - Intronic
932402161 2:71488518-71488540 GAACAACCTGTTAAATGAGGAGG + Intronic
933478593 2:82823877-82823899 TAAGAACTTGTCAAATGATCAGG - Intergenic
939123204 2:138143048-138143070 TAAGGGACTGTAAAATGATCTGG + Intergenic
941049333 2:160714535-160714557 TAAAGACCTTTTAAATTTGCTGG - Intergenic
943099912 2:183475217-183475239 TAAGGACATTTTAAAAGAGCTGG - Intergenic
943653679 2:190484091-190484113 TAAGCACCTGTTATGTGAGTTGG + Intronic
945009679 2:205447671-205447693 TAAGATACTGTTAAATCAGCCGG - Intronic
945928966 2:215835607-215835629 TAAGGACATGCTTAATGGGCAGG + Intergenic
1168956617 20:1838695-1838717 TTATGACCTGTTTTATGAGCGGG + Intergenic
1169595692 20:7195618-7195640 ATAGGACCAATTAAATGAGCAGG + Intergenic
1170217422 20:13906219-13906241 TAAGGAACTGTTACAGTAGCTGG + Intronic
1173338127 20:42129879-42129901 TCAGGACCTTTTAAAGGTGCAGG - Intronic
1183035438 22:35137635-35137657 AAAGGGCCAGTTAAATGAACTGG - Intergenic
1183935153 22:41257790-41257812 TCAGGACATGTTCAAAGAGCTGG + Intronic
1184488854 22:44797575-44797597 TAAGGAACTGTGAAATGAAGAGG + Intronic
949360425 3:3226347-3226369 TAAGGACCTGTAAAGTCAGATGG - Intergenic
957236332 3:77597099-77597121 TAAATACATGTTAAATGAGATGG - Intronic
960158501 3:114322669-114322691 TAAGTACCTGTTAAAAGCTCTGG + Intergenic
960818349 3:121698110-121698132 TATGGATCTGTTCAGTGAGCAGG + Exonic
962646235 3:137443893-137443915 GATGGACCTGTAACATGAGCAGG - Intergenic
964193039 3:154028201-154028223 TAATGTCCTTTTAAATGTGCAGG + Intergenic
967971761 3:195004625-195004647 TTAGGACCTGCAAACTGAGCTGG - Intergenic
969070357 4:4532600-4532622 TAAGGACCTTTTCAATGAGATGG - Intronic
969584881 4:8085739-8085761 TAAACACCTGTGAAATGTGCTGG - Intronic
969908783 4:10423803-10423825 GAAGGACCTGTTCAAGGAGAAGG - Intergenic
974655741 4:64818367-64818389 TAAGGACCTGTTAAAGTCCCTGG + Intergenic
975834236 4:78404846-78404868 GAAGGTCCTGTTAAAGGGGCTGG - Intronic
979414243 4:120417159-120417181 TGAGGACCTCTGACATGAGCTGG - Intergenic
980023219 4:127733779-127733801 TTAGGCCATGTGAAATGAGCTGG + Intronic
983527086 4:168770427-168770449 TAAGGACCTGTTAAATGAGCAGG - Intronic
985283291 4:188308097-188308119 TATGGACCTGTTAAATAAATTGG - Intergenic
988439561 5:31217082-31217104 TATAGACCTGTTAAATGAAGTGG + Intronic
990489615 5:56291402-56291424 TATTGACCTGCTAAATAAGCTGG + Intergenic
991094683 5:62727423-62727445 TAAGGGCCTGTGAAATAAGTGGG + Intergenic
998888769 5:146723724-146723746 TCAGGACCTGTTAGAAGATCAGG - Intronic
1001318475 5:170661392-170661414 TAATGGCCTGTAAAATGAGGGGG + Intronic
1004380966 6:15132100-15132122 TAAGGACCAGGAAAATGGGCTGG - Intergenic
1007601080 6:43081699-43081721 TGAGGACCTGTTATATCGGCTGG - Intronic
1008601129 6:53096486-53096508 TCAGGACCTTCCAAATGAGCAGG - Intronic
1011460735 6:87600690-87600712 TAAGGGCATGTCAAATCAGCGGG + Intronic
1017322009 6:153105356-153105378 TAAGGACCTATTATCTGTGCTGG + Intronic
1021698770 7:23298150-23298172 TAATGACCCATTAAATGAGCTGG + Intergenic
1030407297 7:109130250-109130272 TAAAGACCTACTAAATCAGCCGG - Intergenic
1033960001 7:146902999-146903021 TGAGGACCAGTAAAATCAGCTGG - Intronic
1035458977 7:159027817-159027839 CAAGAACCTGTTAATAGAGCAGG - Intergenic
1035828199 8:2667397-2667419 TAAACACCTGTTCAACGAGCAGG - Intergenic
1038119459 8:24596310-24596332 TAGGCACCTGTTAAAACAGCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1043199846 8:77353184-77353206 TTAGCACCTTATAAATGAGCTGG + Intergenic
1043637959 8:82410927-82410949 TATTGACCAGTTAAATGAGTTGG + Intergenic
1047033944 8:120914189-120914211 TAAGTGTCTGTTAAAGGAGCTGG + Intergenic
1047524193 8:125618489-125618511 AAATGAGCTGTTAAATGAACAGG - Intergenic
1048878330 8:138854012-138854034 TTAGAACCCCTTAAATGAGCAGG + Intronic
1056200940 9:84275736-84275758 CAAGGACCAGGAAAATGAGCTGG - Exonic
1056438682 9:86598231-86598253 TAAGGAAATGTGAAATGTGCGGG - Intergenic
1059968483 9:119639840-119639862 TAAGGAGCTTTTAAAAGACCAGG - Intergenic
1189316115 X:40057815-40057837 TAATGAACAATTAAATGAGCTGG + Intronic
1190750815 X:53359926-53359948 TAAGGACCTGTACAATCTGCTGG - Intergenic
1191032022 X:55984281-55984303 TGGGGACCTGTTAGGTGAGCGGG - Intergenic
1193767670 X:85550625-85550647 TAAGAACCTGTAAAATAAGATGG - Intergenic
1194182645 X:90733278-90733300 AAAAGACATGATAAATGAGCAGG + Intergenic
1196549208 X:117001794-117001816 AAAGGAACTGTTAAAAGAGTTGG + Intergenic
1200529267 Y:4315233-4315255 AAAAGACATGATAAATGAGCAGG + Intergenic