ID: 983534253

View in Genome Browser
Species Human (GRCh38)
Location 4:168840423-168840445
Sequence TTGTGTATAAAGAAGGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983534253 Original CRISPR TTGTGTATAAAGAAGGGCCA AGG (reversed) Intronic
904111172 1:28127653-28127675 TAGTGTATGGAGAAGGGGCATGG + Intergenic
909225408 1:73014580-73014602 TTTTCTATAAAGAAGGGCCTAGG + Intergenic
910551531 1:88480993-88481015 TAGTGTATAAGGAAAGCCCATGG + Intergenic
911834819 1:102604189-102604211 CTGTGAATTAAGAAAGGCCAAGG + Intergenic
911944288 1:104086518-104086540 TAGTTTTTAAAGAAGGGACAAGG + Intergenic
912677957 1:111703360-111703382 TTGTATATGAAGAACGGCCAAGG + Exonic
913986054 1:143567072-143567094 TTGTGTCTAAAGAACGGAGATGG - Intergenic
915785826 1:158610810-158610832 TTTACTGTAAAGAAGGGCCATGG - Exonic
918195055 1:182213438-182213460 TTGTGTGCCAAGAAGAGCCAGGG - Intergenic
919534801 1:198774234-198774256 TTGTGTGCTAAGAAGGACCAGGG + Intergenic
921807508 1:219472910-219472932 TTGTGTAGATAGAACGCCCATGG + Intergenic
922185631 1:223271801-223271823 TTCTGTGGAAAGAAGGTCCATGG - Intronic
924064007 1:240205759-240205781 TTGAGTAGAAAGAAGGGCATTGG - Intronic
1064830450 10:19459540-19459562 TTTTGTTTAAAGAATGGCCTTGG - Intronic
1065317126 10:24473934-24473956 TGGTGTATATAGAAAAGCCACGG + Exonic
1069364434 10:67682381-67682403 TTATGTAAAAAGAAGGGCAATGG + Intronic
1070451966 10:76568177-76568199 TTGTATAAAAAGAAGGGATATGG - Intergenic
1070575488 10:77674125-77674147 TATTGTAAAGAGAAGGGCCAGGG + Intergenic
1071586818 10:86831200-86831222 TCGTGTATAAGGAAGGTGCAGGG - Intronic
1074345201 10:112678346-112678368 TTGTTTATAAGGAAGGCCTAGGG - Intronic
1077116175 11:885595-885617 TTGGCTATAGAGAAGGGCCCAGG - Intronic
1080229240 11:30000033-30000055 TTGTGTGGAAAGAAGAACCATGG + Intergenic
1080600604 11:33818218-33818240 TTGATTATAACAAAGGGCCATGG + Intergenic
1080861154 11:36151306-36151328 TTGTGTAGTAAGATGGGCCAGGG + Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084883078 11:72185943-72185965 TTGTATATTTAGAAGGGACAGGG - Intergenic
1085038181 11:73311857-73311879 TTGGGGCCAAAGAAGGGCCATGG + Intronic
1085278345 11:75314217-75314239 TTGTGTGTAAGGAAGGGATAGGG + Intronic
1086584870 11:88439073-88439095 TTGTCAAAAAAGTAGGGCCAAGG + Intergenic
1089121474 11:116138655-116138677 TTGTGTATAAAGCCAGGCCCTGG - Intergenic
1089710293 11:120309714-120309736 TATAGTATAAAGAAGGGCGAGGG + Intronic
1091851947 12:3706558-3706580 ATCTGTAAAATGAAGGGCCAGGG + Intronic
1094076865 12:26486259-26486281 TTGTGTATACAGAAGAGAAATGG - Exonic
1095666138 12:44800952-44800974 TTCAGTATAAATAAGAGCCAAGG + Intronic
1096047147 12:48572277-48572299 TTGCTTATAGGGAAGGGCCAAGG - Intergenic
1096225183 12:49861590-49861612 TTGTGTAGAAAGAAGTAACATGG + Intergenic
1097777153 12:63661112-63661134 TAGTGTGTAAATAATGGCCAGGG - Intronic
1098099830 12:67003188-67003210 TTGGGTAGAAAGAAGGGCGTTGG - Intergenic
1100209166 12:92383459-92383481 TTCCGTTTAAAGAAGGGACAGGG + Intergenic
1101080676 12:101180417-101180439 TTGTATATAAAGAAAGGCTCAGG + Intronic
1103324761 12:120113062-120113084 TTGTGTTTTAAGTAGGGACAGGG + Intronic
1104870073 12:131988737-131988759 AGGAGGATAAAGAAGGGCCACGG - Intronic
1106366140 13:29082785-29082807 TATTGTATACAGCAGGGCCAAGG + Intronic
1106618190 13:31349861-31349883 TTGTGGATAAAAGAGGGTCATGG - Intergenic
1109464977 13:62719109-62719131 TTGTTTTTAAAAATGGGCCATGG + Intergenic
1109548433 13:63860222-63860244 TTGTGCATAAACAAGGGACCTGG + Intergenic
1112109492 13:96279945-96279967 TTTTGTATAAAAAATGGCAAGGG + Intronic
1113628073 13:111861174-111861196 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1113628079 13:111861216-111861238 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1113628085 13:111861258-111861280 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1116986046 14:51221709-51221731 TTGTGTATCAATTTGGGCCATGG - Intergenic
1118076871 14:62309042-62309064 TTAATTATAAAGAAGGGTCATGG + Intergenic
1118634916 14:67739387-67739409 TTGTGTAACAAGAAGTCCCAAGG - Intronic
1118940964 14:70337257-70337279 TTGTTTATAAATAATGTCCATGG - Intronic
1119409862 14:74423838-74423860 TTGTGAGTAACAAAGGGCCAGGG - Intronic
1119417519 14:74483175-74483197 TTGTATATGAAGAATGGCCAAGG + Intronic
1121391311 14:93577298-93577320 TTGGGCATAGAGTAGGGCCAAGG + Intronic
1122472346 14:101978482-101978504 TTGTGTATAAAGTACTGGCAAGG + Intronic
1122549661 14:102543230-102543252 CTGTGTCTAAAGATGGCCCAGGG + Intergenic
1125599798 15:40909156-40909178 ATGAGTATAAAGAAGGACCTAGG - Intergenic
1127675039 15:61229965-61229987 TTGTGAATCTAGAAGCGCCATGG + Intergenic
1128565050 15:68695551-68695573 TGCTGTCTAAAGAAGGGCAAGGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1139176277 16:64692219-64692241 ATGCATTTAAAGAAGGGCCATGG - Intergenic
1139332309 16:66202878-66202900 TTATGTATAAAGAACCTCCACGG - Intergenic
1141748704 16:85943898-85943920 TTCTGCCTAAAGAAGAGCCATGG - Intergenic
1141767634 16:86069251-86069273 TTGTTTAAAAAGAAGGGCATTGG + Intergenic
1145894401 17:28445336-28445358 TTGTGTATGAAGAATAGCCAAGG - Intergenic
1148902809 17:50891332-50891354 TTCTGGATAAACAAGGGCCAGGG - Intergenic
1151640513 17:75389069-75389091 GTGTGTATAAAGAATTGCAAGGG - Intronic
1153619721 18:6966105-6966127 GTGTGTATACAGTAGGGCCTAGG + Intronic
1155517970 18:26641716-26641738 TTGTGCCTAAAGAAGGGGCATGG - Intronic
1156807206 18:41199308-41199330 TTTTGTATAAATAAGGGCAAAGG - Intergenic
1159699800 18:71611311-71611333 TTATGTAGAAAGAATGGACAGGG - Intergenic
1159856299 18:73593551-73593573 ATGTGCATAAAGAATTGCCAGGG + Intergenic
1161512175 19:4677897-4677919 TTGTGTATAAAGAGGGCCTGGGG + Intronic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1163775277 19:19213673-19213695 TTGTGTATCTGGAGGGGCCAAGG + Intronic
1166123256 19:40698659-40698681 TTGTGGAGAAAGAAGAGGCAAGG + Intronic
1167832416 19:52036378-52036400 TTTTGTATAAAGAAAAGACAAGG + Intronic
1168637275 19:58006151-58006173 TTCTGTATAAACAAAGGGCAAGG + Exonic
927325134 2:21796533-21796555 TTGTGTATTAAGAAGCTACAGGG - Intergenic
927727446 2:25437432-25437454 TTGTGTTTTAAGTAGGGACAGGG + Intronic
929240796 2:39651106-39651128 GTGTGTTTGAAGAAGGGACATGG + Intergenic
929706848 2:44222551-44222573 GTGTGTATAAATAAGGGGCCTGG - Intronic
931500803 2:62864017-62864039 TTGTGTATTAAGTAGAGACAGGG + Intronic
931800314 2:65751524-65751546 TAGTGTTTGAAGAAGGGCTAAGG + Intergenic
932953306 2:76319035-76319057 TTATGTATAAACTAGGGCAACGG + Intergenic
938143449 2:128814005-128814027 TATTGTATGAAGAATGGCCAGGG - Intergenic
939625031 2:144466500-144466522 TTATGTAGAAAGATGGGCCATGG - Intronic
940499947 2:154481239-154481261 TTCTGCATAAAGAAAGACCATGG - Intergenic
946437991 2:219671724-219671746 TTGTGGAGAAAGAACTGCCATGG + Intergenic
1178297598 21:31423452-31423474 ATGTGTATAATGATGGGGCAGGG - Intronic
1182400765 22:30075516-30075538 TTTTGTAGAAAGAAAGGCAAAGG - Intergenic
1184360103 22:44011438-44011460 TTTTGTATAAAGTAGAGACAGGG - Intronic
951850277 3:27131687-27131709 TTATCTAAAAATAAGGGCCACGG + Intronic
953713811 3:45298304-45298326 TTGTGTTTAAAGGACAGCCAAGG + Intergenic
954387277 3:50250710-50250732 GTCTGTGTAAAGAAGGACCAGGG - Intronic
956825787 3:72996272-72996294 TTTTATATAGAGAAGGGCGAGGG + Intronic
957544760 3:81623230-81623252 GTGTGTTTAAAGGAAGGCCAGGG - Intronic
958180398 3:90052423-90052445 TTCTGAATAAAGAAGGGCCAGGG + Intergenic
958263054 3:91404572-91404594 TTGTGTATAAAGAGGGATCATGG - Intergenic
960670992 3:120155221-120155243 CTGTGGCTAAAAAAGGGCCAAGG - Intergenic
961250780 3:125503365-125503387 TTTTGTCTAAAGAAAGGCAAGGG - Intronic
962424919 3:135261368-135261390 TTGTGGACAAAGCAGGGTCAAGG + Intergenic
962486343 3:135846380-135846402 GTATGTAGAAACAAGGGCCAAGG - Intergenic
965022262 3:163247565-163247587 TTCTGTATAAAGAAAGTCTATGG + Intergenic
965949359 3:174287016-174287038 TTTTTTAAAAAGAAGGGCAAAGG + Intergenic
969691225 4:8705301-8705323 TTGTGTATCAGGAGGGGCTAAGG + Intergenic
970239702 4:13995625-13995647 GTTTGGATAAAGAAGAGCCAGGG + Intergenic
970434997 4:16024653-16024675 TTGTCTTTAGAGAAGGGCAATGG - Intronic
970759550 4:19468379-19468401 TTGTGTAGGAAGAAGGGTTAGGG + Intergenic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
973340326 4:48996742-48996764 TTGTGAGTAAAGCAAGGCCAGGG - Intronic
973636157 4:52863109-52863131 TTGTCTGGAAAGAAGGGTCAAGG + Intronic
975132535 4:70843356-70843378 TTGTAGATAGAAAAGGGCCAAGG - Intergenic
975733809 4:77362911-77362933 TGGTGTCTAAGGAATGGCCACGG + Intronic
975774275 4:77767348-77767370 TTATGTATGAGGAAGAGCCACGG + Intronic
979039129 4:115764457-115764479 TGCTGTAGAAAGAATGGCCAGGG + Intergenic
979478601 4:121187533-121187555 TTGTTAATAAAGAAGGACCATGG + Intronic
980073786 4:128271556-128271578 ATGTGTATAAAGACCAGCCATGG - Intronic
982369295 4:154616853-154616875 TTGTGTATAAAAATAGCCCAGGG + Intergenic
982644944 4:158011405-158011427 TTGTGTATAAACTAGAGCCTTGG - Intergenic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
986463853 5:8001275-8001297 TTGTGTCTAAAGAGGGTTCATGG - Intergenic
987483379 5:18490203-18490225 TTGTGTATAAATAAGGCGCCAGG - Intergenic
989766483 5:45090845-45090867 TTGTGTAATAAGAACTGCCAGGG + Intergenic
992347049 5:75889974-75889996 TTTTGAAGAAAGAAAGGCCAAGG + Intergenic
998304800 5:141063150-141063172 ATGTGTATGAAGAAGAGACATGG - Intergenic
998370762 5:141659617-141659639 TTGTGGGAGAAGAAGGGCCAGGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1003565087 6:7215939-7215961 TTGTGTGTGAAGAAGGCCCAAGG + Intronic
1004140193 6:13011028-13011050 ATGTGTGTGAAGAAGGGCCCAGG - Intronic
1004526603 6:16414792-16414814 TTGAGTAGAAAGAAGGACAAAGG - Intronic
1004916571 6:20338385-20338407 TTGTGTGTACATGAGGGCCAAGG + Intergenic
1007024799 6:38559896-38559918 TTGTGTATAATGAAGGGGAGAGG - Intronic
1007075824 6:39065554-39065576 TTGTGTGTAAAGAAGGGAAAAGG + Intronic
1007136791 6:39530146-39530168 CTGTGTATATAGAAAGGCCCAGG - Intronic
1007183242 6:39945891-39945913 ATGTGTATAAGGTGGGGCCATGG + Intergenic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008542553 6:52557885-52557907 TTGTGTCTAAAAAATGGCCATGG - Intronic
1008992353 6:57618316-57618338 TTGTGTATAAAGAGGGATCATGG + Intronic
1009180976 6:60517428-60517450 TTGTGTATAAAGAGGGATCATGG + Intergenic
1009715875 6:67394535-67394557 TTGTGACTAAACAAGGGCCAAGG + Intergenic
1012277404 6:97291089-97291111 TTATGTACAAAGAAGGGTAAGGG - Intergenic
1013743585 6:113318455-113318477 TTGTGAGTGAAGAAGGGTCAGGG - Intergenic
1014846708 6:126286664-126286686 TGGTGGAGAAAGAAAGGCCAAGG - Intergenic
1020065174 7:5182875-5182897 TTCTTTAAAAAGAAGGGCTATGG - Intergenic
1021446256 7:20736845-20736867 TTCTGTATAAAGGTAGGCCAAGG - Intronic
1022361257 7:29660656-29660678 TAGTGTGTAAATAATGGCCAGGG + Intergenic
1022936069 7:35178786-35178808 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1024970855 7:55068860-55068882 ATGTGTAGAAAGAAGGGTCAGGG + Intronic
1029832037 7:103271502-103271524 TAGTGTGTAAATAATGGCCAGGG - Intergenic
1030913810 7:115286987-115287009 TTATTAATAAAGAAGGTCCATGG + Intergenic
1032265592 7:130368004-130368026 TGGTGTCTGAAGCAGGGCCAGGG - Intronic
1032505967 7:132435015-132435037 TTATGCATAAAGAAGGGCTGGGG - Intronic
1036002666 8:4625566-4625588 TCGTGTATACAGGAGAGCCAGGG - Intronic
1037453103 8:19036813-19036835 TAGTGTCTAAAGAAGAGCCCTGG - Intronic
1037644960 8:20784846-20784868 TTGTGTAACAAGAAGGCCTATGG - Intergenic
1041113782 8:54513723-54513745 TTGGGTATAAAGAAAGAACATGG + Intergenic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1045004740 8:97908042-97908064 TTGTGGTAAAAGATGGGCCAAGG + Intronic
1045086658 8:98693999-98694021 TTGTGAAAAAAGTAGTGCCATGG + Intronic
1046576098 8:116030943-116030965 TTGTGTTTAAAGAAAGATCATGG - Intergenic
1047110052 8:121780007-121780029 CTTTGTATAGAAAAGGGCCATGG - Intergenic
1047574649 8:126139422-126139444 TTGAGTATAAAGGAGAACCAAGG - Intergenic
1050880268 9:10690731-10690753 TTTTGTATAAAGAAAGGTGACGG - Intergenic
1057481798 9:95450496-95450518 TTGTGATTAATGAAAGGCCAGGG - Intronic
1058581371 9:106461914-106461936 TTATGTATAAAGAAGGGGAGTGG - Intergenic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1060088043 9:120719097-120719119 TAGTGTATAGAGAAGAGCCTGGG - Intergenic
1060880894 9:127117307-127117329 TTCTTTAAAAAGCAGGGCCAGGG + Intronic
1060900461 9:127253197-127253219 TAGTGTCTAAAGAAGGGACAGGG - Intronic
1061890819 9:133618201-133618223 TTGTTTACAAGGAGGGGCCAGGG - Intergenic
1188100934 X:26083564-26083586 ATGATTGTAAAGAAGGGCCATGG + Intergenic
1190574363 X:51818189-51818211 TGGTGTATAAAACAGGTCCAAGG - Intronic
1191633781 X:63353867-63353889 TTGTGAATCAAGGAGGGCTATGG + Intergenic
1197863060 X:130990741-130990763 TGGTGAATAAAGAATGGCTAGGG - Intergenic
1198368184 X:135964873-135964895 CAGTATATAAACAAGGGCCATGG + Exonic