ID: 983534480

View in Genome Browser
Species Human (GRCh38)
Location 4:168842756-168842778
Sequence ATGAGGGCATGGAGAGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1018
Summary {0: 1, 1: 1, 2: 6, 3: 114, 4: 896}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983534480_983534486 17 Left 983534480 4:168842756-168842778 CCGTCTTCTCTCCATGCCCTCAT 0: 1
1: 1
2: 6
3: 114
4: 896
Right 983534486 4:168842796-168842818 CATTTAAGTAGATGACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983534480 Original CRISPR ATGAGGGCATGGAGAGAAGA CGG (reversed) Intronic
900333404 1:2148501-2148523 ATGGAGGCCTGGATAGAAGACGG - Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900771518 1:4548389-4548411 ATGAGGGCATGGGTGGAAGGTGG + Intergenic
900993456 1:6108236-6108258 ATGGAGGGATGGAGAGATGACGG + Intronic
901293847 1:8145655-8145677 ATGAGGGCACAGCGAGAAGGCGG + Intergenic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
902089242 1:13890152-13890174 GTGAGGACATAGAGAGAAGCTGG - Intergenic
902277590 1:15350652-15350674 ATGAGGGCATGGAGAGGGCAAGG - Intronic
902649752 1:17829411-17829433 AGGAGGGCCTGGAGAGGAGATGG + Intergenic
902723240 1:18318270-18318292 GTGAGGGCAAGGTGAGAATAAGG - Intronic
902762019 1:18587440-18587462 ATGAGGGCAGGGAAAGGAGGTGG + Intergenic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903226774 1:21898361-21898383 GAGAGGGCAGGGAGAGGAGAAGG - Intronic
903331695 1:22600015-22600037 AGGAGGGAAGGGAGAGAAGGAGG + Intronic
904447993 1:30590032-30590054 ATTAGGTTATGGAGAGATGAAGG - Intergenic
904883436 1:33717709-33717731 AAGAGGGCTAGGAGAGAAGAGGG + Intronic
905124399 1:35707239-35707261 AAGAGGGCATGAACAGGAGAGGG + Intergenic
905379744 1:37553331-37553353 GTGAGAGATTGGAGAGAAGAGGG - Intronic
905507099 1:38488761-38488783 ATGAGGACATGGTGAGAACATGG - Intergenic
905663790 1:39749359-39749381 GTGAGGGCAGGGAGAGCAGTGGG - Intronic
905876241 1:41433585-41433607 ATGAAGGCCAAGAGAGAAGACGG - Intergenic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906518830 1:46455603-46455625 ATGAGGGCACGGGTAGAGGAGGG - Intergenic
906829227 1:49014114-49014136 ATGTGCACATGGAGAGAAGGGGG - Intronic
907020386 1:51060828-51060850 ATCCAGGCATGGAGAGGAGAGGG - Intergenic
907208302 1:52794925-52794947 AGGAGGGCAAGGACAGAAGCAGG - Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
908395279 1:63719742-63719764 ATGGGGGCATGGGGAGGTGATGG + Intergenic
909344666 1:74571702-74571724 ATGAGGGCATGGGAGGAGGAAGG - Exonic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
910965947 1:92808078-92808100 ATGGAAGCATGGAGAGCAGATGG + Intergenic
911139139 1:94479250-94479272 ATGACTGCAAGGAGACAAGAAGG - Intronic
911272118 1:95814905-95814927 GTGAGGACATGGTGAGAAGGTGG + Intergenic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913594052 1:120356382-120356404 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914093204 1:144522608-144522630 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914305320 1:146411280-146411302 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914596737 1:149161532-149161554 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914783523 1:150807433-150807455 AGGAGGGAAGGGAGAGAAAAAGG - Intronic
914841891 1:151255187-151255209 ACGAGGGAATGGGGAGAGGAAGG - Intronic
915684078 1:157613627-157613649 ATGAGGGAATAAAGAGAAGCTGG + Intergenic
916004624 1:160648119-160648141 TTGTGGGCATAGAGAGTAGAAGG - Intergenic
916017943 1:160766900-160766922 ATGAGGACAGGGAGAGATGAAGG + Intergenic
916296320 1:163224180-163224202 AGGAGGGCATGGAAAGAGGATGG - Intronic
916773454 1:167936234-167936256 TCGAGGGCATGGGGAGAAGGAGG - Intronic
917036069 1:170748187-170748209 ATGAGGGAAGGGAGAGTAGGAGG - Intergenic
917132655 1:171758412-171758434 ACCAGGGCATGGAGGGAAAATGG + Intergenic
917152772 1:171962598-171962620 ATGAGGTCATGGAATGAAGATGG - Intronic
917231753 1:172845276-172845298 ATGAGTGCAGAGGGAGAAGAGGG - Intergenic
917243312 1:172973122-172973144 AAGATGGGATGGAGAGATGATGG - Intergenic
919469100 1:197956844-197956866 ATAAGGACATGGAAAGAAGGTGG + Intergenic
919470588 1:197974292-197974314 CTGAGGGCAGGGAAAGTAGAAGG + Intergenic
920255148 1:204649674-204649696 ATTAAGGCCTGGAGAGGAGAAGG - Intronic
921301359 1:213754236-213754258 GTGAGGACGTAGAGAGAAGACGG - Intergenic
921688404 1:218118525-218118547 ATGAGGACATAGTGAGAAGTTGG - Intergenic
922093810 1:222423785-222423807 GTGAGGGCATAGTGAGAAGGTGG - Intergenic
922134764 1:222814275-222814297 AGAAGGGCATGCAGAGAAGAAGG - Intergenic
922249400 1:223834120-223834142 ATGAGGGCAGGGAGAACAGGGGG + Intronic
922475707 1:225905721-225905743 AAGAGAGCAGGGAGAGTAGATGG + Intronic
922505517 1:226123376-226123398 GGGAGGGCCTGGAGAGGAGAGGG - Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922616069 1:226961884-226961906 ATGAGGACACAGTGAGAAGATGG - Intronic
922697423 1:227737779-227737801 ATGAGGGCAGGGACAGGAGGCGG + Intronic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923331357 1:232927749-232927771 ATGAGGCCATGGAGAAGAGCAGG + Intergenic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
923700289 1:236293722-236293744 ATGAGGACCCAGAGAGAAGATGG + Intergenic
924255543 1:242179274-242179296 ATGAGGGCAAGGGGAGCAGACGG + Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924297475 1:242603023-242603045 AAGAGGGAAAGAAGAGAAGAAGG - Intergenic
924583594 1:245342706-245342728 ATGAGGCCTTGGCAAGAAGAAGG + Intronic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1062838936 10:654682-654704 ATGAGGACAGGGAGATAAGAGGG - Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063147888 10:3312975-3312997 ATGAAGCCAGGGAGAGAGGAAGG - Intergenic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1064243595 10:13652183-13652205 ATGAGGCCATGGGTAAAAGAGGG - Intronic
1064895358 10:20229187-20229209 ATGAGGGAAGGGAGACAGGAGGG + Intronic
1064990389 10:21251744-21251766 ATGAGGACACAGAGAAAAGATGG + Intergenic
1065139135 10:22703562-22703584 ATGAGGGCAAGGAGGAAAGTGGG + Intronic
1066521657 10:36226679-36226701 AGGAGAGCAAGGAGAGAGGAGGG - Intergenic
1067068474 10:43116550-43116572 ATGAGGGAAGGGGGAGAAGAGGG - Intronic
1067346075 10:45440057-45440079 AGCAGGGCAAGGAGGGAAGAGGG + Intronic
1067800137 10:49353132-49353154 AGGAGTGCCAGGAGAGAAGAGGG - Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068769311 10:60803331-60803353 AAAAGGGCATAGAGTGAAGAAGG + Intergenic
1069191761 10:65500557-65500579 ATGAGAACATGGAGACAGGAAGG + Intergenic
1069248324 10:66236873-66236895 AGGAGGTCAAGGAGAGAGGACGG + Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069567185 10:69471575-69471597 AAGAGGGGAGGGAGAGAAGGTGG - Intronic
1069577015 10:69538010-69538032 ATGAGGACAGAGTGAGAAGATGG - Intergenic
1069783046 10:70968962-70968984 ATGAAGTCAGGGAGAGAAGGAGG + Intergenic
1070825492 10:79388116-79388138 ATGGGAGCATGGAGACCAGAGGG - Intronic
1070843561 10:79504652-79504674 ATGAGGTCATGGTGAGGACAGGG - Intergenic
1070930106 10:80254948-80254970 ATGAGGTCATGGTGAGGACAGGG + Intergenic
1071161322 10:82749093-82749115 TTGAGGGCTTGGAGAGAGGAGGG + Intronic
1071377055 10:85017305-85017327 ATTGGGGAATGAAGAGAAGATGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072288726 10:93942382-93942404 AAAATGGCATGGAGAGAAAAAGG + Intronic
1073037690 10:100575723-100575745 CTGATGGCATGGAGAGAGGGCGG - Intergenic
1073096422 10:100983077-100983099 ATGAGAGCATGGAGAGAGAATGG + Intronic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073421743 10:103429539-103429561 GTGAAGACATGGGGAGAAGATGG - Intronic
1074186748 10:111104748-111104770 ATGAGGCCAGGGAGAAAAGTTGG - Intergenic
1074293551 10:112160259-112160281 AAGAGAGGAAGGAGAGAAGAGGG - Intronic
1074364093 10:112844382-112844404 CTGAGGTCATGGAAAGGAGAAGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074550038 10:114434108-114434130 AGGAGGGCACAGAGAGAGGATGG + Intronic
1075453314 10:122568425-122568447 AAGAGGGCAAAGAGAGAACATGG + Intronic
1075568616 10:123522187-123522209 GTGAAGGCCTGGAGAGAGGAGGG - Intergenic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1076169820 10:128309815-128309837 GGGAGGCCATGGAGAGAAGCAGG + Intergenic
1076448760 10:130540307-130540329 ATGAGGTCACAGTGAGAAGATGG - Intergenic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077888747 11:6404070-6404092 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1077923199 11:6656148-6656170 AATAGGGGATGGAAAGAAGATGG - Intergenic
1078067087 11:8085651-8085673 ATGAGGGCAGGAAGAGGAGAAGG + Intronic
1078184830 11:9042705-9042727 AACAGGGCATGGTGAGATGAGGG + Intronic
1078361394 11:10670812-10670834 ATGAGGACACAGAGAGAAGGTGG + Intronic
1078461300 11:11517061-11517083 GTGAGGACACGGTGAGAAGATGG + Intronic
1078625428 11:12951528-12951550 ATGAGGAGATGGCGAGAAGGAGG + Intergenic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1080036452 11:27717676-27717698 AGAAGGTGATGGAGAGAAGAAGG - Intronic
1080054946 11:27896824-27896846 ATGAGGGCAGGGAAATCAGAGGG + Intergenic
1080695037 11:34596072-34596094 GTGAGGTCACGGTGAGAAGATGG + Intergenic
1080781493 11:35433844-35433866 ATGAGGGGATGGATAGATGGAGG + Intronic
1080825124 11:35842001-35842023 ATGAGCACATGGAGACTAGAAGG - Intergenic
1080848921 11:36050907-36050929 ATGAGGACACAGTGAGAAGACGG - Intronic
1080915968 11:36659907-36659929 ATTAAGGCAAGGAGAAAAGAGGG + Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081686050 11:45043683-45043705 GTGAGGTCATAGTGAGAAGATGG + Intergenic
1082160625 11:48884720-48884742 CTGACAGCAGGGAGAGAAGAAGG - Intergenic
1082161741 11:48895686-48895708 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1082167325 11:48964114-48964136 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1082609747 11:55282461-55282483 CTGACAGCAGGGAGAGAAGAAGG - Intergenic
1082656936 11:55868064-55868086 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1082887989 11:58108669-58108691 ATGAAGACCTGGAGAAAAGATGG + Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084245774 11:67856054-67856076 ATCAGGGCACAGAGATAAGAGGG + Intergenic
1084826911 11:71738524-71738546 ATCAGGGCACAGAGATAAGAGGG - Intergenic
1085096409 11:73763994-73764016 GTGAGGGCACAGTGAGAAGATGG - Intergenic
1085129234 11:74023553-74023575 ATGAAGGAAGGCAGAGAAGATGG - Intronic
1085923936 11:80991831-80991853 ATGAGGACACAGAGAAAAGAAGG - Intergenic
1086022842 11:82252750-82252772 ATGATGGAATGGGGAGAATATGG - Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086667993 11:89508641-89508663 AAGAAGTCATGGAGAGAGGATGG + Intergenic
1086962431 11:92992443-92992465 ATGAGAGGAGGGAGAGAAGCAGG - Intergenic
1087505388 11:99013911-99013933 ATGAGGGCTTGGAGTGGAAATGG + Intergenic
1087772548 11:102226323-102226345 ATGAGGGGAGAGAGAGAACAAGG + Intronic
1088219310 11:107550830-107550852 GTGAGGACATTGAGAGAAGGTGG + Intronic
1088355045 11:108934151-108934173 AGGAGGGCAAGGAGTGAGGATGG + Intronic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089171983 11:116518441-116518463 ATGAAGGCAAAGTGAGAAGACGG - Intergenic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1090590657 11:128263456-128263478 GAGAGGGCATGAAGAGAAGTTGG - Intergenic
1090733866 11:129594404-129594426 AATAGGGCATGAAGAGAAGGGGG + Intergenic
1090760976 11:129836673-129836695 GTGAGGACACTGAGAGAAGATGG + Intronic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091085187 11:132714893-132714915 CTGAGGGCTTGGAGAGGAAATGG + Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091590830 12:1842195-1842217 ATCAGGGCGTGGAGTGCAGAAGG + Intronic
1091634284 12:2185610-2185632 GTGAAGACATGGGGAGAAGAGGG + Intronic
1091770622 12:3148879-3148901 AGGAGGGGATGAGGAGAAGAGGG + Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091916376 12:4273879-4273901 GTGAGGGCAGAGAGAGAAGGTGG - Exonic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1093120913 12:15270528-15270550 AAGAGGGCCAGGAGTGAAGAGGG + Intronic
1093547830 12:20369134-20369156 TTGTGGGCCTGGGGAGAAGAAGG + Intergenic
1093568179 12:20633728-20633750 ATGAGCCCCTGGAGAGAAGTGGG + Exonic
1093743729 12:22716119-22716141 AGGAGGGCAGGGAGAAAAAAAGG + Intergenic
1094000950 12:25693457-25693479 ATGAAGGAAAGGAGAGAAGGAGG + Intergenic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096120289 12:49084558-49084580 GTGAGGACATAGAGAGAAGGTGG - Intergenic
1096233340 12:49909703-49909725 GTGAGGCCAAGGAGAGAAGAAGG + Intergenic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1097007750 12:55931358-55931380 ATGAGGGCGTGGAGAAAGGGTGG + Intronic
1097141739 12:56908298-56908320 AGGAGGGCATGGGGAGGAGGTGG + Intergenic
1097404590 12:59174925-59174947 GTGAGAACATAGAGAGAAGACGG - Intergenic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1098067692 12:66636780-66636802 GTGAGGACATGAAGAGAAGGTGG + Intronic
1098918818 12:76284186-76284208 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1099475023 12:83097825-83097847 ATGAAGGCCTAAAGAGAAGATGG + Intronic
1099568788 12:84286244-84286266 ATAAGGGAATGGAGAGAAATAGG - Intergenic
1099693429 12:85991250-85991272 AGGAGAGGATGGAGAGATGATGG - Intronic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100689247 12:97021983-97022005 ATGGAGGGAGGGAGAGAAGAAGG - Intergenic
1101141285 12:101798307-101798329 AGGAGGGCATGTAGAGTAGAAGG - Intronic
1101408718 12:104452203-104452225 ATAATGGCAGGGAGAGAAGGGGG - Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102131991 12:110538884-110538906 ATAAGGGAATAGAGAGTAGAAGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102514588 12:113437855-113437877 ATCGGGGGATGGAGAGAGGAAGG - Intronic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1102743297 12:115227156-115227178 AGGAGGGCATGGGGAGAATGAGG + Intergenic
1102792554 12:115659466-115659488 ATGGGGGCAAGGAGAAAAGCAGG - Intergenic
1103072893 12:117959524-117959546 ATGAGAGCAGGGAGACAAGTTGG - Intronic
1103130549 12:118464773-118464795 ATGAGGGCCTGAATAGAACAAGG + Intergenic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103367023 12:120390801-120390823 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1103870745 12:124089862-124089884 ATGAGCAAATGGAGAAAAGAGGG - Intronic
1103894326 12:124263284-124263306 ATTAGGACATGGAGAGAGAAGGG - Intronic
1104294494 12:127499642-127499664 GTGAGGGCGTGGTGAGAAGCTGG + Intergenic
1104425373 12:128672753-128672775 AGAATGCCATGGAGAGAAGATGG + Intronic
1104678867 12:130735028-130735050 ATGAGTGGATGGAGAGAATGTGG - Intergenic
1104899387 12:132180371-132180393 GTGAGGGCACGGTGAGAAGGTGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105424498 13:20282963-20282985 AAGAGGGCAGAGAGAGATGATGG + Intergenic
1106313501 13:28574341-28574363 AGGAGAGCATGGAGATAACAAGG - Intergenic
1106347944 13:28897851-28897873 ATGAGAACATGGACACAAGAAGG + Intronic
1106376121 13:29190011-29190033 ATGAGGACATAGTGAAAAGATGG + Intronic
1106441712 13:29779957-29779979 TGGAGGGCAGGAAGAGAAGAGGG - Intronic
1106572052 13:30935491-30935513 AAGAGGGCAGGGAGAGACAAGGG + Intronic
1106765534 13:32909599-32909621 ATGAGGGGAGGGCTAGAAGATGG + Intergenic
1107483427 13:40804158-40804180 ATGAGGACACAGTGAGAAGACGG - Intronic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1108026688 13:46185339-46185361 ATGAGTGCATGGAGAGGAAGTGG - Intronic
1108316254 13:49240609-49240631 ATGAGAGGATGGATAGGAGAGGG - Intergenic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108690357 13:52853945-52853967 ATGAGGACACAGAGAGAAGGCGG - Intergenic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1109326385 13:60872559-60872581 AGGAAGGCAAGGAGAAAAGATGG - Intergenic
1109690240 13:65878589-65878611 ATGAGGCAATGGAGAAAAAAAGG - Intergenic
1109943479 13:69402281-69402303 ATAAAGGAAAGGAGAGAAGAAGG + Intergenic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110264949 13:73527011-73527033 ATAGGGGCATGGAGAGAATGGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1112744581 13:102512250-102512272 GTGAGGGCATGGCAAGAAGGTGG + Intergenic
1112849547 13:103688153-103688175 AGGAGGGGATAGAGAGAAGTTGG - Intergenic
1112896574 13:104306579-104306601 ATGGGGACGTGGTGAGAAGATGG + Intergenic
1113101062 13:106719629-106719651 GTGAGGACATACAGAGAAGATGG - Intergenic
1113140947 13:107148490-107148512 AGGAGGGGAAGGAGAGAAAAAGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113162316 13:107395776-107395798 GTGAAAACATGGAGAGAAGACGG - Intronic
1113426623 13:110213685-110213707 ACGAGGGCAAGGAGAAAGGAGGG + Intronic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113936630 13:113998303-113998325 AGGAGGGCATGGGAAGAGGAGGG - Intronic
1114621561 14:24099237-24099259 GTGAGGGCCTGGTGAGAAGCAGG + Intronic
1117582336 14:57164621-57164643 CTGAGGGCATGAAGAGAGGGTGG + Intergenic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118225025 14:63890564-63890586 ATGAGGGGAGGGAGACAGGAGGG + Intronic
1118615331 14:67571316-67571338 GTGAGAGTATGGGGAGAAGATGG - Intronic
1118707376 14:68492780-68492802 ATGAGGTCCTGGAGAGACAATGG - Intronic
1119223147 14:72925409-72925431 ATGAGGGAAATGAGAGAAGTGGG - Intergenic
1119833195 14:77722252-77722274 ATGAGGGCATAGAGTAAAGTAGG - Intronic
1119861851 14:77941752-77941774 ATGAGGACATAGTGAGAAGGTGG + Intergenic
1119969636 14:78955292-78955314 GTGAGGGCATTGAAAGAAAATGG - Intronic
1120024213 14:79564277-79564299 AAGAGGGCATTGAGAGAAAGTGG + Intronic
1120487798 14:85136896-85136918 ATGAGGAAATGGAGAGATGGTGG + Intergenic
1121080956 14:91108034-91108056 ATGAGAGCAGGAAGAGAAAAAGG + Intronic
1121109103 14:91300310-91300332 ATCAGGGCATGGAGGGACTATGG - Intronic
1121240439 14:92426068-92426090 ATCAGGGCAGGGAGAGAGGTGGG + Intronic
1121866302 14:97365845-97365867 ATGATGTCATGGACAGGAGAGGG - Intergenic
1121995947 14:98603013-98603035 AAGATGGCAGGGAGAGCAGAAGG + Intergenic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124964614 15:34423847-34423869 ATGAGGGGGTAGGGAGAAGAGGG - Intronic
1125796549 15:42408196-42408218 ATGATGGGCTGGAGAGAGGAGGG - Exonic
1126111891 15:45180033-45180055 CTGAGGGCATGAATAGAACAAGG - Intronic
1126454839 15:48849721-48849743 ATGACGGAAAGGAGAGAGGAAGG + Intronic
1126475939 15:49065243-49065265 AAGAGTGCAGGGAGAGAAGCAGG + Intergenic
1126692319 15:51297283-51297305 ATGGGGGCATGTGGAGATGAGGG - Intronic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127932992 15:63609722-63609744 ATGAGGACAGGGAGAGGAGAGGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128220394 15:65964608-65964630 ATGGGAGCAAGGAGAGAACAAGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128671671 15:69578451-69578473 ATGAGGGCAAGGTGAGGAGGAGG + Intergenic
1129324928 15:74794823-74794845 ATGTGATCATGGAGAGCAGAAGG - Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1130423142 15:83768392-83768414 ATGGAGGGAGGGAGAGAAGAAGG + Intronic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131024268 15:89126560-89126582 AGGAGGGCATGCTGAGAAGCAGG - Intronic
1131205254 15:90439888-90439910 ATGAGGGGTTGGGGAGAAAAAGG + Intronic
1132020417 15:98356557-98356579 AGGAAGGGATGGAGAGAGGAAGG + Intergenic
1132273845 15:100549304-100549326 TTGAGGGCATGGAGAGGGAATGG + Intergenic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1133517448 16:6523244-6523266 AGGAGGGAAGGAAGAGAAGAAGG + Intronic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1135606572 16:23831150-23831172 AGGAAGGCAGGGAGAGAGGAAGG - Intergenic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136170054 16:28483679-28483701 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1136291063 16:29271652-29271674 ATGAGGGAGGGGAGAAAAGAAGG + Intergenic
1136479974 16:30534941-30534963 ATTAGGGCAAGGAGAGAACTGGG - Intronic
1136483837 16:30558469-30558491 ATGAGGGTACGGAGAGAACGCGG - Intronic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137458747 16:48638593-48638615 ATGAGGACGTGGGGAGAAGACGG + Intergenic
1137555740 16:49469248-49469270 ATGAAGGCCTGGAGAGAGGAGGG - Intergenic
1137570910 16:49565867-49565889 AGGAGAGAATGGAGAGGAGAGGG + Intronic
1137721264 16:50628902-50628924 ATGAGGGCACAGTGAGAAGGTGG - Intronic
1137739468 16:50753492-50753514 ATGGAGGCAAGGAGAGAAGCTGG - Intronic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1139120221 16:64007314-64007336 ATAAGGACACAGAGAGAAGAAGG + Intergenic
1139455430 16:67071440-67071462 ATGAGGACACAGTGAGAAGATGG + Intronic
1139657877 16:68399912-68399934 ATGAGGCTACGGAGAGAAGCTGG - Intronic
1139684304 16:68590776-68590798 AGGAGGGAAGGGAGAAAAGAAGG - Intergenic
1140341996 16:74173627-74173649 GTGAGGGCACGGCAAGAAGACGG - Intergenic
1140642265 16:76989889-76989911 ATTAGGGCAGGGAGAAAAAATGG + Intergenic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141535666 16:84678046-84678068 GTGAGGACACGGGGAGAAGACGG - Intergenic
1141563548 16:84886209-84886231 ATGAGGGAATGAAGAGAGGCGGG - Intronic
1141664406 16:85458470-85458492 AAGGGGGCATGGAGAGATGGAGG + Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1203087445 16_KI270728v1_random:1191787-1191809 AAGAGGGCATGGAGAGGGGAGGG + Intergenic
1142870743 17:2818817-2818839 AGGGAGGCATGGAGAGATGAAGG - Intronic
1142878840 17:2869001-2869023 GTGAGAACATGGCGAGAAGACGG - Intronic
1143762699 17:9116485-9116507 AAGAGGGCAGGGAGAGGAGGGGG - Intronic
1143904769 17:10199255-10199277 GGGACGGAATGGAGAGAAGACGG + Intergenic
1144003567 17:11078209-11078231 GTGAGGGCAGGTAGAGCAGATGG + Intergenic
1144037066 17:11376646-11376668 AGGGAGGCATGAAGAGAAGAAGG - Intronic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144392856 17:14812273-14812295 ATGGGGGCTTGAAGAAAAGAAGG - Intergenic
1144877870 17:18411768-18411790 AAGAGGGCGTGGGGAGAGGACGG - Intergenic
1145154359 17:20532657-20532679 AAGAGGGCGTGGGGAGAGGACGG + Intergenic
1146151328 17:30475258-30475280 TTGATGGCAAGGAGTGAAGATGG - Intergenic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146645027 17:34571565-34571587 AGGAGGCCATGGAGAGAAGTTGG + Intergenic
1147176775 17:38660694-38660716 AGGAGCTTATGGAGAGAAGAGGG - Intergenic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1148218600 17:45847375-45847397 ACCTGAGCATGGAGAGAAGATGG - Intergenic
1148580186 17:48738328-48738350 TGGAGGGCATGGAGAGACCAGGG - Intergenic
1148868325 17:50640874-50640896 ATGAAGGCGTGGAGAGAGCAAGG - Intronic
1149707119 17:58705266-58705288 ATGAGGACACAGAGAAAAGATGG - Intronic
1150306926 17:64093582-64093604 GTGAGGACATGGTGAGAAGGTGG - Intronic
1150714136 17:67557170-67557192 GTGAGGGCATAGCAAGAAGATGG - Intronic
1151346800 17:73507359-73507381 AAGAGGGCATGGTGAGGAGGGGG - Intronic
1151541623 17:74767659-74767681 AGGAGGGCCTTGAAAGAAGAAGG - Intronic
1151751982 17:76044438-76044460 AAGGGGCCATGGAGTGAAGACGG + Intronic
1152003235 17:77660436-77660458 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1152822917 17:82446244-82446266 ACGAGGGCATGGAGGTCAGAGGG + Intronic
1152987826 18:335590-335612 TTGAGGGCACAGGGAGAAGATGG + Intronic
1153129430 18:1837766-1837788 ATGAGGGAATGGAAAGATGGGGG - Intergenic
1153319674 18:3760242-3760264 ATGAGGGCCTGGAGAAAATCAGG + Intronic
1153449779 18:5214211-5214233 TTAAAGGCAAGGAGAGAAGAAGG - Intergenic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1155897289 18:31346139-31346161 ATGAGGGAATGTAGAGAAGGAGG + Exonic
1156243941 18:35279663-35279685 ATGAGGACACAGTGAGAAGATGG - Intronic
1156372293 18:36482413-36482435 ATGAGGACAAGGGGAGAAGCAGG + Intronic
1156861110 18:41837399-41837421 AGGCTGGCCTGGAGAGAAGACGG - Intergenic
1157307554 18:46528278-46528300 TTCAGTGCATGGAGAGGAGAAGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157502017 18:48197671-48197693 GTGAGGGCACAGTGAGAAGATGG - Intronic
1157595019 18:48859182-48859204 ATGAGGACAGGGAGAGTGGAAGG - Intronic
1157772111 18:50358349-50358371 ATGAAGACATGCAGAGAGGATGG - Intergenic
1157939303 18:51909527-51909549 TTGAGGGCCTAAAGAGAAGATGG + Intergenic
1158946787 18:62453987-62454009 AGGAGGGCATGGGGTCAAGAGGG - Intergenic
1159555170 18:69938306-69938328 TAGAGGGCATAGAGAAAAGAGGG - Intronic
1159564298 18:70031788-70031810 GGGAGGGCATCGAGAGCAGATGG + Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159864364 18:73686984-73687006 ATGAAGGCCTGAAGAGAGGATGG - Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1159881082 18:73859122-73859144 AGGGGGGCATGCAGGGAAGAAGG + Intergenic
1159921178 18:74228617-74228639 ATGAGGACATAGAGACAAGGTGG + Intergenic
1160041758 18:75351975-75351997 ATGAGGACACAGAGAGAAGGTGG + Intergenic
1160177276 18:76605728-76605750 ATGAGTGAATGGATAGAAGGTGG - Intergenic
1160225880 18:77010067-77010089 AGGACGACAGGGAGAGAAGAAGG + Intronic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1161161818 19:2765836-2765858 AGGAGGGCGTGGGGGGAAGATGG + Intronic
1161191367 19:2958807-2958829 ATGGGGCCATGGGAAGAAGATGG - Intergenic
1161329150 19:3678197-3678219 ATGAAGGGATGGAGAGATGGAGG + Intronic
1162274007 19:9638800-9638822 AAGAGGGGATGCAGAGGAGAAGG + Intronic
1163094966 19:15050578-15050600 ATGAAGGAATGGATAGAAGGAGG + Intronic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163674087 19:18646709-18646731 ATGCGGGCATGGCGGGCAGAAGG - Intronic
1163861906 19:19747266-19747288 ATGAGGACTTGGTGAGGAGACGG + Intergenic
1164587069 19:29482621-29482643 TTGAGGGCAGGGGGAAAAGAAGG - Intergenic
1165102187 19:33445538-33445560 ATGAGGACATGGCAAGAAGGCGG + Intronic
1165582187 19:36876101-36876123 ATGATAACATTGAGAGAAGATGG - Intronic
1165874062 19:38993214-38993236 ATGAGGGCATGGAGAGTTATGGG + Intronic
1168239110 19:55080486-55080508 ATGAGGACATGAACAGAACATGG + Intronic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
1168655621 19:58125513-58125535 ATGGAGGCACGGAGTGAAGAAGG - Intergenic
1168677931 19:58292372-58292394 ATAAGGGCACAGAGAGAAGGCGG - Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925521036 2:4746083-4746105 GTGAGTCCATGGTGAGAAGATGG - Intergenic
925537077 2:4929308-4929330 ATGAGGGGAAGCAGAGAAAAGGG + Intergenic
925602737 2:5625753-5625775 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
925645113 2:6027920-6027942 ATGAGGAATTGAAGAGAAGAGGG - Intergenic
925648842 2:6067282-6067304 ATCAGGACACAGAGAGAAGATGG - Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926137061 2:10343821-10343843 ATGAGGGCAGAAAGAGAAGAGGG + Intronic
926457099 2:13080407-13080429 ATGAGGACCTAGTGAGAAGATGG + Intergenic
926687790 2:15711333-15711355 ATGAGGGGATAGAGAGAAATCGG + Intronic
926836566 2:17030375-17030397 GGAAGAGCATGGAGAGAAGAGGG - Intergenic
927037325 2:19192117-19192139 AGGAGCGCAGGGAGACAAGAAGG - Intergenic
927090147 2:19704492-19704514 TTTAGGCCATGGAAAGAAGAGGG - Intergenic
927220654 2:20705483-20705505 AAGAGGGGATGGAGAAAACAGGG - Intronic
928500510 2:31888810-31888832 ATGAGGGGATTGAAAGAAGGGGG + Intronic
928766343 2:34651012-34651034 ATGATGCAATGGAAAGAAGAGGG + Intergenic
928965729 2:36973419-36973441 TTGAGGGCCTGGAGAGTAGAGGG - Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929635984 2:43521214-43521236 AGGAGGGCAGGCAGACAAGAAGG + Intronic
930311168 2:49741087-49741109 ATGAGGCCCTGGAGAGAGAAAGG - Intergenic
930892031 2:56401210-56401232 GTGAGGGCAAGGATAGAAGAAGG - Intergenic
930926694 2:56826832-56826854 ATGTGGGCATGGAGAAATGTTGG + Intergenic
931061005 2:58529933-58529955 ATGAAGAGATGAAGAGAAGAAGG + Intergenic
931556971 2:63516917-63516939 ATGAGGACAGGGAGAGAAACAGG + Intronic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932054724 2:68432732-68432754 AAGAGAGGATGGAGAGATGATGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932640740 2:73443323-73443345 ATGAGATCAAGGAGACAAGAGGG - Intronic
932808264 2:74801409-74801431 ATGAGGACATGGCGAGAAGGCGG + Intergenic
932833373 2:75011635-75011657 ACAAGGGCAGAGAGAGAAGATGG + Intergenic
932852750 2:75201961-75201983 ATGGAGGCAGGGAGAGAAGGCGG - Intergenic
932854630 2:75220360-75220382 AAGAGGGCATGGAGAGATGTTGG - Intergenic
933006540 2:77002680-77002702 ACAAGGGCAAGGAGAGAACAAGG - Intronic
933100983 2:78257106-78257128 AAGAGGGAATGAAGAGAAGCTGG - Intergenic
933319715 2:80758015-80758037 AGAAGGGCATTGAGAGTAGATGG - Intergenic
933493622 2:83019909-83019931 GTGAGGACATAGAGAGAAGGTGG - Intergenic
933779307 2:85790543-85790565 ATGTGGCCATGGAGACAGGAAGG - Intergenic
933858754 2:86442905-86442927 ATGAGGGGAGGGAGAGAATTGGG + Intronic
933995206 2:87663126-87663148 GTGAGGGCATAGAGAGGGGAGGG - Intergenic
934220071 2:90074430-90074452 GTGAGGACATGGACAGAAGGTGG + Intergenic
934851880 2:97706991-97707013 ATGAGGGCCGGGATAGGAGAAGG + Intergenic
934859862 2:97755589-97755611 ATGATGGCTTGGAGACAAGGGGG - Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936298654 2:111287787-111287809 GTGAGGGCATAGAGAGGGGAGGG + Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937201779 2:120208729-120208751 ATGAGGGGATGGCCAGTAGAAGG - Intergenic
937354403 2:121188910-121188932 ATGAGTGAATGGATAGATGAAGG + Intergenic
937488487 2:122340773-122340795 ATGAAGACATAGGGAGAAGATGG + Intergenic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938071823 2:128312445-128312467 ATGGGGGCATGTAGAGAGGCTGG - Intronic
938112511 2:128578505-128578527 ATGAGGTGATGGAGAGGGGATGG - Intergenic
938262000 2:129903153-129903175 ATGAGGGGATGGGGAGGAGGGGG - Intergenic
939291311 2:140198904-140198926 ATGAGGAGAAGGGGAGAAGAAGG + Intergenic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939812520 2:146852107-146852129 ATGAGGACAAGGAGAGACAATGG - Intergenic
939985738 2:148827879-148827901 ATGAGGACACAGAGAGAAGGTGG + Intergenic
940605172 2:155914048-155914070 GTGAGGACATAGTGAGAAGATGG - Intergenic
940860828 2:158769103-158769125 GTGACAGCATGGTGAGAAGAGGG - Intergenic
941072058 2:160966671-160966693 ATCAGGGCAGGGAGAGGAGCAGG + Intergenic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
943000962 2:182328398-182328420 ACGAGGGCATTGAGAGTACATGG + Intronic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
943404157 2:187458880-187458902 ATGAGAGCATACATAGAAGAGGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943973625 2:194443037-194443059 GTGAGGACATGAAAAGAAGAGGG - Intergenic
944087857 2:195870112-195870134 ATGAGTGCATAAAGAGAGGAAGG - Intronic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
944211086 2:197207196-197207218 ATCATGGCATGGAGGGAAGGGGG + Intronic
944360119 2:198844332-198844354 GAGAGAGCATGAAGAGAAGAGGG - Intergenic
944377860 2:199068868-199068890 ATGAGGGCACAGTGAGAAGGAGG + Intergenic
944388761 2:199194944-199194966 ATGAGGGAATGGGGAGGAGGAGG - Intergenic
944504936 2:200401598-200401620 ATGAGGCAAAGGAGAGAAGGTGG - Intronic
945406143 2:209451396-209451418 AGCAGGGCATGGAGGGAAGGGGG - Intronic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
946168695 2:217880890-217880912 ATGACGGCATGGAGGGTAGGTGG - Exonic
946180934 2:217948528-217948550 GGGAGGGCATGGTCAGAAGAGGG - Intronic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946940723 2:224767658-224767680 TTAAGGGCAGGGAGAAAAGAAGG - Intronic
947023349 2:225708922-225708944 ATGAGGTCAGGGAGAGAGGCAGG + Intergenic
947181751 2:227417402-227417424 TTGAGGGCATGGGGAGAAAGAGG + Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
947625854 2:231618249-231618271 AGAAGGGCATGGAGACCAGAGGG - Intergenic
947777854 2:232728721-232728743 AAGAGGGCATGCAGAGAGTAGGG - Intronic
947854099 2:233311641-233311663 ATGGGGGCAGGTAGAGAAGTGGG - Intronic
948240176 2:236424794-236424816 ATCAGGGAATGGAGAGATGTTGG - Intronic
948321867 2:237076296-237076318 AGGAGAGCATGGAGAGTGGATGG - Intergenic
948582639 2:238998287-238998309 ATGAAGGAAGGGAGAGAAGGAGG - Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
1169189864 20:3651733-3651755 ATGAGGTCATTGAAAGAAGGAGG + Intergenic
1169728587 20:8762698-8762720 ATGAGGCCATGGAGAAAACCAGG - Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170409517 20:16073591-16073613 ATGAGGGATGAGAGAGAAGAAGG + Intergenic
1170745770 20:19097715-19097737 ATCTGGGCATGGGCAGAAGATGG + Intergenic
1170757624 20:19218448-19218470 AGGAGGACATGAATAGAAGACGG + Intronic
1170861124 20:20104822-20104844 GTGAAGACATGGGGAGAAGATGG - Intronic
1171041794 20:21770867-21770889 GTGAGGGCATGGAGATGAGGTGG + Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172316049 20:33955235-33955257 ATGATAGCAGGGAAAGAAGAAGG + Intergenic
1172845169 20:37925828-37925850 AGGAGGACAGGGAGAGAAGCAGG - Intronic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173955385 20:47028415-47028437 GTGGGGGCAAGAAGAGAAGAAGG - Intronic
1174486763 20:50866110-50866132 AAGCGGGCTTGGAGAGAACAGGG - Intronic
1174655359 20:52167490-52167512 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175112504 20:56658419-56658441 ATGAGGGCTCTGAGAGAGGATGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175273912 20:57754499-57754521 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1175489696 20:59371567-59371589 AAGAGGTCAGGGAGAGAGGAAGG - Intergenic
1175569925 20:60010725-60010747 AGGAGGAGATGGTGAGAAGAGGG + Intronic
1176458261 21:6931752-6931774 GTGAGGGCATAGTGAGAAGGAGG - Intergenic
1176836435 21:13796846-13796868 GTGAGGGCATAGTGAGAAGGAGG - Intergenic
1177295410 21:19166966-19166988 ATGTGGCAATGAAGAGAAGATGG + Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177733852 21:25063820-25063842 ATGGGGTCATGGGGAGAAGTTGG - Intergenic
1178021789 21:28416708-28416730 ATCAGGGAAAGGAAAGAAGAGGG - Intergenic
1178251098 21:31004059-31004081 ATGTGGGCATTGAGAGGAAAAGG + Intergenic
1178441207 21:32599843-32599865 ACAAGGGCAGGGAGAGAGGATGG + Intronic
1178803055 21:35815068-35815090 AGGAGGGAAGGAAGAGAAGAGGG - Intronic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179236735 21:39554141-39554163 AGGAGGACATGGAGAGAGGAAGG - Intergenic
1179451565 21:41471975-41471997 AAGAGGTCTGGGAGAGAAGAAGG + Exonic
1179502785 21:41820521-41820543 ATGAGGACACAGGGAGAAGACGG + Intronic
1179718882 21:43304338-43304360 ATGAGGACGCGGGGAGAAGACGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1181613633 22:24036671-24036693 ATGAATGGATGGAAAGAAGAAGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181759227 22:25046403-25046425 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181759231 22:25046419-25046441 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181974259 22:26717631-26717653 ATGAGTGCAAGGACAGGAGAGGG + Intergenic
1182029744 22:27148634-27148656 GTGAGGACACGGCGAGAAGACGG + Intergenic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1182113580 22:27742080-27742102 AGGAGGGAAAGGAGAAAAGAGGG - Intergenic
1182144698 22:27990296-27990318 GAGAGGCCATGGAGAGTAGAAGG + Intronic
1182180717 22:28345413-28345435 AGGAGGGCTTGGAAAGGAGATGG - Intronic
1182369644 22:29801914-29801936 ATGAGGGAAGGAAGAGAGGAAGG + Intronic
1182881781 22:33739839-33739861 ATGAGGGCATGGAAGGAGGCGGG + Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1183576939 22:38697192-38697214 AAGAGGTGAGGGAGAGAAGATGG - Intronic
1184766283 22:46574226-46574248 ATGAGGACACGGAGAGAAGGCGG - Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949632950 3:5949001-5949023 ATGAAGCCCTGGAGAGAAGGTGG + Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
949852448 3:8432905-8432927 AAGAAGGCAGGGAGGGAAGAAGG + Intergenic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950214849 3:11152310-11152332 ATGAGGGGTTGGGGAGCAGAAGG - Intronic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
950924152 3:16723383-16723405 ATGAGGGCATAGTGAGAAGGTGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952204734 3:31169883-31169905 TTGAGGGCATGTGGAGAAAAGGG - Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952758403 3:36892222-36892244 ATGAGGGCATGAAGGGGATACGG + Exonic
953124837 3:40081815-40081837 ATGGGGGCATGGGGAGATGTTGG - Intronic
953190766 3:40685435-40685457 ATGATGACATCGAAAGAAGATGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954538795 3:51380399-51380421 ATGGGGGCAGGGAGATCAGAGGG + Intronic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
956203817 3:66735629-66735651 AGGAGAGCAAGGAGTGAAGATGG + Intergenic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956593317 3:70939669-70939691 AAGAAGGCAGGGAGGGAAGAAGG - Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956932742 3:74063991-74064013 GTAATGACATGGAGAGAAGATGG - Intergenic
956952833 3:74301971-74301993 ATGCGGGGAGGGAGAGTAGAGGG - Intronic
957424446 3:80020142-80020164 GTGAGGGCATAGAGAGGAGGTGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959349842 3:105248323-105248345 GTGAGGACATGGAAAAAAGATGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959759863 3:109947991-109948013 GTGAGGACAGGGAGAGAAGGTGG + Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961208493 3:125107043-125107065 AAGAGGGGATGGACAGAAGGTGG - Intronic
961248872 3:125482378-125482400 ATGAGGTGAAGGAGAGGAGAAGG - Intronic
962240008 3:133744291-133744313 CGCAGGGCATGGAAAGAAGATGG - Intergenic
962265350 3:133940573-133940595 ATGAGGCCATGATGAGGAGAGGG - Intronic
962978727 3:140469035-140469057 GTGAGGACATGGTGAGAAGGAGG - Intronic
963075830 3:141345437-141345459 ATGGGGGCATGAAGAAATGAGGG + Intronic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
964195559 3:154060055-154060077 ACGAGAGCCTAGAGAGAAGACGG + Intergenic
964870083 3:161303873-161303895 ACGAGGGCCGGGAGAGAAGAAGG - Intergenic
964993954 3:162851009-162851031 ATGAGTTCATAGAAAGAAGAGGG - Intergenic
965389557 3:168088695-168088717 AAGAGGGCAGGGAAAGAAAAGGG - Intronic
965651919 3:170943131-170943153 AAGCGGGCAGGGAGAGATGAGGG - Intergenic
965937364 3:174130642-174130664 ATGATGGCCAGGAGAGAAAATGG + Intronic
966159865 3:176956302-176956324 ATGAGGCCCTGGAGTCAAGAAGG - Intergenic
966270323 3:178097026-178097048 ATGAAGGGAAGGAGAGAGGAAGG + Intergenic
966366905 3:179198251-179198273 TTGAGGGCAGGGAGTGAAAAAGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967165000 3:186772629-186772651 ATAAGGTGATGGCGAGAAGATGG + Intergenic
967281596 3:187828764-187828786 ATTAGGGCAGGAAGTGAAGAAGG + Intergenic
967334014 3:188322340-188322362 ACCAGGGCATGCAGTGAAGAAGG - Intronic
967611962 3:191517207-191517229 ATGAGGGCGAGGAATGAAGATGG - Intergenic
967637277 3:191818056-191818078 ATAGGGACATGGAGAGAAAATGG - Intergenic
967774910 3:193376319-193376341 GTGAGGGCACAGAGAAAAGATGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968229258 3:196995663-196995685 AAGAGGGCAGGAAGAGAAGGAGG + Intronic
969004015 4:4004984-4005006 ATCAGGGCACAGAGATAAGAGGG + Intergenic
969045280 4:4332015-4332037 GTGAGGACATGGCGAGAAGGTGG + Intergenic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
970060018 4:12022401-12022423 ATGAGGGCATGGCAAAAAGTGGG + Intergenic
970171103 4:13291222-13291244 AGGAAGGCATTGAGAGTAGATGG - Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970400174 4:15709631-15709653 AGGAGGGCATAGATAGAAAAGGG - Intronic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971366824 4:25984355-25984377 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
971596236 4:28532953-28532975 ATGTGGGCATATACAGAAGATGG + Intergenic
971781748 4:31044007-31044029 ATGAGAGAAAGGAGAGAAGATGG + Intronic
972632320 4:40853155-40853177 CAGAGGGCATGAAGAGAAGCAGG - Intronic
972670335 4:41209075-41209097 ATGAGAGCTGGGAGAGAGGAAGG - Intronic
972973407 4:44604841-44604863 ATGAGGACACAGAGAAAAGATGG - Intergenic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973833772 4:54789098-54789120 AGGAGGGGAAGGAGAGAGGAGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
974602527 4:64103973-64103995 ATGTGCACATGGAGAAAAGACGG - Intergenic
975044439 4:69783836-69783858 AGGAGAGGATGGAGAGAGGATGG + Intronic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975660952 4:76688913-76688935 AAGAGGGCATGCTGAGAAAAAGG + Intronic
975848833 4:78551568-78551590 ATGAGGGCGTAGGGAGAAAAGGG + Exonic
975877699 4:78863613-78863635 GTGATGGCAAGGAGAAAAGAAGG + Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976488709 4:85641518-85641540 ATGAAGACCCGGAGAGAAGATGG - Intronic
977093169 4:92704805-92704827 AAGAAGGCAGGGAGAAAAGAGGG - Intronic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978625399 4:110679708-110679730 AAAAGGGAATGGAGAGAGGAAGG - Intergenic
978847137 4:113286928-113286950 AGAAAGGCATGGAGAAAAGATGG - Intronic
979403908 4:120285375-120285397 AGCAGAGCATGGAGAGAAGCAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980091689 4:128449481-128449503 AAGAGGAAATGTAGAGAAGAGGG + Intergenic
980670010 4:135993438-135993460 ATAAGTGGATGGAAAGAAGAAGG - Intergenic
980962743 4:139492590-139492612 AAGAAGGCATGGGGAGGAGAAGG - Intergenic
980996499 4:139784475-139784497 ATCACAGCAGGGAGAGAAGAGGG - Intronic
981698500 4:147582859-147582881 ATAAGGGCACAGAGAGAAGGTGG - Intergenic
982296054 4:153830684-153830706 ATGGGGGCAAGGAGAGTAGCTGG + Intergenic
982296753 4:153836782-153836804 AGGAGAGCCTGGAGAGAGGAAGG - Intergenic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983324386 4:166234637-166234659 ATGAGGACACGGAGAGGGGATGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
984962695 4:185112954-185112976 GTGTGGGCATTGAGAGAATATGG + Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985273840 4:188219034-188219056 AGGAGCACATGGACAGAAGAAGG - Intergenic
985486857 5:156671-156693 ATGAGGGAATGGAAAGAGCAGGG + Intronic
986341233 5:6791106-6791128 ATCAGAGCAGGGAGAGGAGATGG - Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
987650667 5:20736442-20736464 AAGAGGTGATGGAGAGAGGAAGG - Intergenic
987910142 5:24132411-24132433 AGGAGGGGAGGGGGAGAAGAAGG + Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988403668 5:30796214-30796236 AGGAGGGAATGGGGAGATGATGG + Intergenic
988785021 5:34558491-34558513 AAGAGAGGAAGGAGAGAAGAAGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
989176163 5:38528524-38528546 GTGATGGCAAGGTGAGAAGAGGG - Intronic
989482151 5:41943939-41943961 ATGAGGACATAGTGAGAAGGTGG + Intergenic
989622804 5:43401323-43401345 TTGGGGGCATGGAGAGTGGATGG + Intronic
989992455 5:50783167-50783189 AGGAGGGAAAAGAGAGAAGAGGG + Intronic
990313072 5:54558369-54558391 ATGATGGAATGGAGAGAGGGAGG - Intergenic
990532121 5:56684516-56684538 ATGAGGGGATGGAGAGAATGTGG - Intergenic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
991260970 5:64667657-64667679 ATGAAGGAAGGGAGAAAAGAAGG + Intergenic
991419106 5:66422657-66422679 ATGAGGGCACAGTGAGAAGGTGG + Intergenic
991645341 5:68795494-68795516 ATGAGGTCATGGAGATAAATTGG + Intergenic
991650502 5:68847739-68847761 ATGAGGGCAGACAGAGAAGAGGG + Intergenic
991712768 5:69424377-69424399 ATCAGGGCATAGAGAGGAGTAGG - Intronic
991970529 5:72136537-72136559 ATGAGGTCTTGGGGAGAAGGAGG - Intronic
992202429 5:74397612-74397634 ATGAAGACACGGGGAGAAGAGGG - Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992701504 5:79345820-79345842 ATTAGGGCCTGGTGAGATGAAGG + Intergenic
992984063 5:82209462-82209484 ATGAGGACATGGCAAAAAGATGG + Intronic
993018607 5:82564200-82564222 ATGAGGGCTTTCAGGGAAGAGGG - Intergenic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993322065 5:86483365-86483387 AGGAGGGCATGGAAAGATGCAGG + Intergenic
993383667 5:87237463-87237485 GTGAGGACATAGTGAGAAGATGG + Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
994287784 5:97991310-97991332 AGGAGGGGGTGGAGAAAAGAAGG + Intergenic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
994539787 5:101079810-101079832 TTGAGGTCATAGGGAGAAGATGG - Intergenic
994753855 5:103770847-103770869 ATGAGAGAAAGAAGAGAAGAGGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995837071 5:116409624-116409646 ATGAAGGCATAGGGAGAAGATGG + Intronic
996369506 5:122738360-122738382 TGGAGGGCATGGAGCCAAGAAGG - Intergenic
996690336 5:126333581-126333603 AAAAGGCCATGGAGGGAAGATGG + Intergenic
996909473 5:128638753-128638775 ATGAAGGCAAGTGGAGAAGAAGG - Intronic
997046728 5:130328239-130328261 AGGAGGGCATAAAGAGGAGATGG - Intergenic
997275028 5:132578417-132578439 ATGAGGTCATGGAAAGACAATGG - Intronic
997443894 5:133927403-133927425 ACGATGGCATGGAGGGGAGAAGG - Intergenic
997732087 5:136189079-136189101 GTGAGGACACGGTGAGAAGATGG - Intergenic
998013602 5:138714947-138714969 GAGAGGGCAGGGAGAGAGGAGGG + Intronic
998372155 5:141668845-141668867 AGGAGGGCATGGGCAGAGGAGGG + Intronic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999343817 5:150797208-150797230 AGGAGGGGAAGGAGAGTAGAAGG + Intergenic
999552343 5:152703040-152703062 ACCAGGGCATGCAGAGGAGAAGG + Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
1000552560 5:162685082-162685104 GAGAGGGCATACAGAGAAGAAGG + Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1001701839 5:173712446-173712468 ATGAGGGCAAGGAGAAAAACCGG + Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003385752 6:5665945-5665967 ATGAGGGTTTGGAGAGGAGGTGG + Intronic
1003517568 6:6829959-6829981 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003734453 6:8862748-8862770 ATGAGGGAAATGAGAGAACATGG + Intergenic
1003998718 6:11571616-11571638 ATGCAGGCATGCAGAGAAGTGGG - Intronic
1004040791 6:11972899-11972921 ATGAGGGCATGGGGAAAGGGAGG - Intergenic
1004380521 6:15128537-15128559 ATGAGGGGCTGGAGACAGGAAGG - Intergenic
1004407437 6:15347218-15347240 ATGAGGATATGGGGAAAAGAAGG + Intronic
1004605419 6:17190115-17190137 ATGAGTGCATGGAGACAGAATGG + Intergenic
1005091999 6:22066952-22066974 AGGAAAGGATGGAGAGAAGAAGG - Intergenic
1005766719 6:29018149-29018171 ATCAGGGCCTGGAAAGAGGAGGG - Intergenic
1005813732 6:29534030-29534052 ATGAGGGAAGCAAGAGAAGAAGG - Intergenic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1006383984 6:33718653-33718675 ATGAGGACATGGGCAGAGGAAGG + Intergenic
1006673642 6:35746368-35746390 ATGAGGGAGAGAAGAGAAGATGG + Intronic
1006905333 6:37529490-37529512 ATGAAGGAATGGAGTGATGAAGG - Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007138759 6:39549960-39549982 ATGAGGGAAGGGAGAGAGGGAGG + Intronic
1007292302 6:40797044-40797066 AGGAGGGGAGGGAGAGAAGCTGG - Intergenic
1007379077 6:41475190-41475212 ATGGGGTCATGGGGAAAAGAAGG - Intergenic
1008239821 6:49097367-49097389 AAGAGGGCGTGGAGCCAAGATGG + Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009576087 6:65463015-65463037 ATGAGGGCAGGAATAGAAGCAGG - Intronic
1010395853 6:75391165-75391187 ATGAGCGCATGGAAGGAGGAGGG - Intronic
1010891421 6:81316277-81316299 ATGAGGACACAGAGAGAAGGTGG + Intergenic
1011349370 6:86405597-86405619 GTGAGGACATGGTGAGAAGGTGG + Intergenic
1012473921 6:99601237-99601259 ATGAGGGCAAGGGGAAAAGAGGG - Intergenic
1012569318 6:100702211-100702233 AGGAGGGAATGGAGAGAAATGGG + Intronic
1012997663 6:105989835-105989857 ATGAGGGCAGAGAGACAACAGGG - Intergenic
1013035428 6:106378065-106378087 ATGAGAGCATGGTGAGGAGTGGG + Intergenic
1013281782 6:108644600-108644622 ATGAGGGCAGGTAGAGAACAGGG - Intronic
1013677514 6:112482095-112482117 ATGACGGCTTAGTGAGAAGAAGG + Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014497005 6:122137719-122137741 AAGAGGGTATGGTGAGAGGATGG - Intergenic
1014719688 6:124901025-124901047 ATGAGCAAATGGAAAGAAGATGG - Intergenic
1015072932 6:129119053-129119075 AAAAGAACATGGAGAGAAGAGGG - Intronic
1015507740 6:134007005-134007027 ATGAGGGCAGGGAGAGATCAGGG - Intronic
1016455978 6:144231208-144231230 AAGAGAGGATGGTGAGAAGAGGG + Intergenic
1016559909 6:145384410-145384432 GTGGGGGCATGGAAGGAAGAAGG + Intergenic
1016804967 6:148203373-148203395 AGGAAGGGAGGGAGAGAAGACGG - Intergenic
1016980450 6:149848948-149848970 ATGAGGACACAGTGAGAAGATGG + Intronic
1017588684 6:155954613-155954635 ATGAGGGCATGGTGAGATCGAGG + Intergenic
1017752733 6:157503439-157503461 ATGAGGGCATGGATAGTCTAAGG - Intronic
1017792883 6:157817034-157817056 GTGAGGACATAGCGAGAAGATGG + Intronic
1018083337 6:160277599-160277621 CTGAGGTCAGGGGGAGAAGATGG - Intronic
1018352523 6:162975761-162975783 AAGAAGGGAGGGAGAGAAGAAGG - Intronic
1018440157 6:163805120-163805142 ATGAAGGCAGTGAGAAAAGATGG + Intergenic
1019103445 6:169650237-169650259 ATGGGGGGATGCAGAGATGAGGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019562183 7:1664671-1664693 AAGAGGGCAGGGAGAGGGGAGGG - Intergenic
1019632604 7:2057939-2057961 AAAGGGGCATGGAGAGAAGCAGG + Intronic
1019671215 7:2280043-2280065 AGGAGGGAGGGGAGAGAAGAAGG + Intronic
1019699925 7:2469745-2469767 AAGAGGGCAGGGAGAGAGGGAGG + Intergenic
1019795160 7:3043579-3043601 AAGAGGGCACGGGGAGGAGATGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020874731 7:13678285-13678307 ATGAGGGGGTGGAGCCAAGATGG - Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021719499 7:23491765-23491787 AGGAAGGCAGGGAGAGAAGGAGG - Intergenic
1021792149 7:24216613-24216635 ATTAGGGCAGGGCGACAAGATGG + Intergenic
1021874579 7:25036636-25036658 GAGAGGGCAAGGAGAGCAGAGGG + Intergenic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022361387 7:29662880-29662902 ATGTGGGCAAAGAGAGACGAAGG - Intergenic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022747452 7:33187525-33187547 ATGAGGGGATGGACAGACGGAGG - Intronic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1022935942 7:35176556-35176578 ATGTGGGCAAAGAGAGATGAAGG + Intergenic
1023236515 7:38095795-38095817 AAGAGGGCAAGGAGAGGAGATGG + Intergenic
1023280328 7:38562663-38562685 AAGAGGGGAGGGAGAGGAGAGGG + Intronic
1023371749 7:39518849-39518871 ATGAGACAAGGGAGAGAAGAAGG - Intergenic
1023449274 7:40265469-40265491 ATGAGGGAAGGAAGAAAAGAAGG - Intronic
1024267848 7:47620519-47620541 GTGGGAGCATGGAGAGAGGAGGG - Intergenic
1024294098 7:47829059-47829081 ATGAAGGCAGGGAGAGAGGAAGG + Intronic
1025072441 7:55912216-55912238 ATGAGGCGATGGAGAGCACATGG - Intronic
1025075923 7:55943110-55943132 AGGAGGGCATGGTGATAATAAGG + Intergenic
1025832973 7:65070288-65070310 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1025902739 7:65759802-65759824 ATGTGTGCAAAGAGAGAAGAGGG - Intergenic
1026137774 7:67678551-67678573 TTGAAGGCAGGGAGAGAAGAGGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1028413769 7:90558449-90558471 AAGAGTGCATGCAGTGAAGATGG + Intronic
1028722438 7:94049002-94049024 ATGAGGACATAGAGAGTAGAAGG + Intergenic
1029058832 7:97776247-97776269 ATCTGGGCATGGTAAGAAGAAGG - Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029538834 7:101171477-101171499 ATGAGGGGCTAGAGAGAAGTGGG + Exonic
1029683308 7:102127775-102127797 ATGAAGGCATAGAAAGAACAGGG - Intronic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030261148 7:107565208-107565230 ATGAGAGCATGCAGAGTAGAGGG - Intronic
1030396431 7:108992384-108992406 ATGAGGTAAGGGAGAGAAGTGGG + Intergenic
1030872301 7:114771654-114771676 ATGAGGGCATGGTGACAATCTGG + Intergenic
1031122885 7:117741203-117741225 ATGGGGGAATGGAGAGCAGGAGG + Intronic
1031367470 7:120920239-120920261 ATAAGGGCATGGATACAGGAAGG - Intergenic
1031500440 7:122507870-122507892 ATGAGGGTAAGGAAAAAAGAGGG + Intronic
1031725675 7:125235185-125235207 ATGAGGACACAAAGAGAAGAAGG - Intergenic
1031989285 7:128186455-128186477 TTGAGGGAAGGAAGAGAAGAAGG - Intergenic
1032661378 7:133987482-133987504 AAGCGGGGAGGGAGAGAAGAAGG + Intronic
1032818450 7:135501440-135501462 ATGAGGGACTAAAGAGAAGATGG + Intronic
1032849245 7:135779408-135779430 AGGAGGGCAGGGAGATAAAATGG + Intergenic
1033048433 7:137982924-137982946 AGGAGGACATAGTGAGAAGATGG + Intronic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1034100832 7:148449043-148449065 GTGAGGACACGGTGAGAAGACGG + Intergenic
1034679208 7:152915817-152915839 ATGAGGGGAGGGGGAGGAGAAGG - Intergenic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034902253 7:154914864-154914886 GTGAGGGCACGGGGAGAAGACGG - Intergenic
1035663401 8:1363679-1363701 GTCAGGACATGGAGAGAAGCTGG + Intergenic
1035690720 8:1557732-1557754 ATGAGGACATGGGGAGAGGACGG - Intronic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036546120 8:9771456-9771478 AAGAAGGGAGGGAGAGAAGAAGG + Intronic
1036678723 8:10854977-10854999 AAAAGGGAATGGAGAGAACAGGG + Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1037472583 8:19225103-19225125 ATCAAGGCAAGGAGAGAAGTTGG - Intergenic
1037552472 8:19988222-19988244 ATGAGGGAAAGAGGAGAAGAGGG + Intergenic
1037681701 8:21103002-21103024 ATGAAGGGATAGAGAGAAAATGG + Intergenic
1037891816 8:22627654-22627676 AGGTGGGCAGGGAGAGAGGAGGG - Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038449356 8:27629715-27629737 GTGAGGCCATGTAGAAAAGAAGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039177753 8:34828386-34828408 ATTAAGGGATGGAGAGAAGTTGG + Intergenic
1039320096 8:36420045-36420067 ATGAGTTGAGGGAGAGAAGAAGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039651643 8:39346706-39346728 ATGACTGCTTAGAGAGAAGAAGG + Intergenic
1039655546 8:39400872-39400894 GTGAGGGCACTGAGAGAAAAGGG - Intergenic
1039737104 8:40344787-40344809 ATGAGTGCACAGAGAGATGATGG - Intergenic
1039783663 8:40813268-40813290 ATGAGGGCATAGGGAGGGGATGG + Intronic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1042103669 8:65300907-65300929 ATGAAGTCATGGGGAGAAGATGG - Intergenic
1042520635 8:69707775-69707797 ATAAGGACAGGGAGAGAGGAAGG + Intronic
1043500030 8:80844352-80844374 CTGAGGCCATAGCGAGAAGATGG - Intronic
1043821193 8:84867132-84867154 GTGAAGACATGGGGAGAAGATGG - Intronic
1044464463 8:92487458-92487480 AGGAGGGCATGAAGTGATGAGGG + Intergenic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1045305191 8:100951840-100951862 ATGAGGGGACGGAGCGAGGACGG + Intronic
1045655857 8:104385785-104385807 AGAAGGGCAAAGAGAGAAGAAGG - Intronic
1045683701 8:104689634-104689656 ATGAGGGCTAGGAGTGAGGATGG + Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047306855 8:123659457-123659479 ATGAGTGGATGGATAGATGATGG - Intergenic
1047550219 8:125863353-125863375 ATGAGGGCAAGGAGAAGTGAAGG + Intergenic
1047685686 8:127302791-127302813 ATGGGGGCATTGAGAGAGCAAGG - Intergenic
1047786009 8:128154459-128154481 GTGAAGGCATACAGAGAAGATGG - Intergenic
1047878047 8:129162103-129162125 ATGATGAGATGGAGAGATGATGG + Intergenic
1048100139 8:131342194-131342216 AAGAGGGTAGGGAGAGTAGAGGG - Intergenic
1048158758 8:131991661-131991683 GTGAAGGCATGGAGAGAAAGAGG + Intronic
1048282014 8:133112592-133112614 GTGAGGGAAGGGAGAGAAAAGGG + Intronic
1048285812 8:133140821-133140843 ATGAGGCCAAAGAGGGAAGAAGG - Intergenic
1048296966 8:133221512-133221534 ATGAGTGGATGGATAGATGACGG + Intronic
1048323456 8:133420438-133420460 ACTAGGTGATGGAGAGAAGATGG - Intergenic
1048363136 8:133715241-133715263 GGGAGGGAAAGGAGAGAAGACGG - Intergenic
1048376010 8:133822795-133822817 CTGAGGGCATGGAGACACTAGGG + Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1048584771 8:135764762-135764784 ATCAGAGAATGGAAAGAAGAGGG + Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048946143 8:139449328-139449350 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
1049155279 8:141062482-141062504 ATGACTGGATGGAGAGAGGATGG + Intergenic
1049501523 8:142970269-142970291 AGGAAGGGATGGAGAAAAGAGGG + Intergenic
1049623163 8:143608172-143608194 AGGATGGCACGGAGAGGAGAGGG + Intronic
1050871297 9:10573584-10573606 AGGAAGGCATTGAGAGCAGATGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051130065 9:13850856-13850878 GTGGGGGCAGGCAGAGAAGAAGG - Intergenic
1051556119 9:18384486-18384508 ATGAGGGCATTGAAGGAGGAAGG - Intergenic
1051682745 9:19624331-19624353 ATGAAAGCAGGGAGAGAAAAAGG + Intronic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1052291993 9:26852473-26852495 AAAAGGGTATTGAGAGAAGAGGG + Intronic
1052656578 9:31370514-31370536 ATGAGAGAATGGGGAGATGATGG - Intergenic
1052734815 9:32330652-32330674 AGGAGGGGATGAAGAGAAGTTGG + Intergenic
1052898578 9:33770702-33770724 GTGAGGACACTGAGAGAAGATGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1055068231 9:72140397-72140419 AAGAGGGCAGAGAGAGAAGTTGG + Intronic
1056387963 9:86115119-86115141 ATAAGGGCATGGATAGCACAGGG + Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1056672533 9:88642743-88642765 AGGAGGACAAGGAGAGGAGAAGG - Intergenic
1057085255 9:92204083-92204105 ATGTGGACATAGTGAGAAGATGG + Intergenic
1057275329 9:93673314-93673336 AGATGGGCATGGAGAGGAGACGG - Intronic
1057430108 9:94986183-94986205 ATGAGGACATGATGAGAAGGTGG - Intronic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058643316 9:107107870-107107892 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1058884817 9:109315011-109315033 ATGAGGGCCTGGCTAGGAGAAGG - Intronic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059343160 9:113611005-113611027 ATGAAGGCACAGGGAGAAGATGG - Intergenic
1059347828 9:113643542-113643564 AAGAAGGCAGGGAGAGAAGAAGG - Intergenic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060439952 9:123629003-123629025 AAGAGGCCATGGAGATAACAAGG - Intronic
1060685364 9:125606200-125606222 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1060874161 9:127068160-127068182 ATGACTGCATGTAGAAAAGAAGG + Intronic
1061259348 9:129471252-129471274 AGGAGGGCATTGAGAGAGGAGGG + Intergenic
1061371402 9:130199624-130199646 ATGACAGCATGGAGGGAGGATGG - Intronic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1185571286 X:1136824-1136846 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185606301 X:1368934-1368956 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606342 X:1369169-1369191 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606385 X:1369404-1369426 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606426 X:1369636-1369658 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606467 X:1369871-1369893 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606550 X:1370333-1370355 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606720 X:1371266-1371288 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606763 X:1371498-1371520 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606936 X:1372433-1372455 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606979 X:1372665-1372687 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607153 X:1373598-1373620 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607278 X:1374297-1374319 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607319 X:1374532-1374554 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607402 X:1374996-1375018 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607490 X:1375462-1375484 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607667 X:1376395-1376417 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610030 X:1388843-1388865 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610065 X:1389077-1389099 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185672189 X:1821682-1821704 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185682023 X:1896832-1896854 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185708457 X:2282611-2282633 AAGAGGGGAGGGAGAGAAGAAGG + Intronic
1185714268 X:2328599-2328621 ATGAGGACACAGGGAGAAGACGG + Intronic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1185986955 X:4845423-4845445 GTGAGGGCACAGAGAAAAGACGG + Intergenic
1186009789 X:5116613-5116635 GTGAGGACACGGGGAGAAGACGG + Intergenic
1186017427 X:5213717-5213739 ATAAGGACACAGAGAGAAGATGG + Intergenic
1186144620 X:6612480-6612502 ATGAGGACACAGGGAGAAGATGG - Intergenic
1186335800 X:8586145-8586167 ATGAGGGCATAGACTGTAGATGG - Intronic
1186818588 X:13262919-13262941 ATGAGGACATAGTGAGAAGTTGG + Intergenic
1187190810 X:17033207-17033229 ATGAGAGCATTTCGAGAAGATGG - Intronic
1187431844 X:19232235-19232257 GTGAGGGCACGGTGAGAAGACGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188833649 X:34931438-34931460 AGGAAGGCATTGAGAGTAGATGG + Intergenic
1188845503 X:35066999-35067021 ATGAGGACGTGGAGAAAAGAGGG - Intergenic
1190036333 X:47028429-47028451 ATGAGGCCATGGAGATTTGAAGG - Intronic
1190585812 X:51940553-51940575 ACTAGAGGATGGAGAGAAGAAGG - Intergenic
1190832484 X:54071615-54071637 ATGAAGGTTTGGAGAGAAAAGGG - Exonic
1191627307 X:63283139-63283161 ATGAGGGCATGGGGTGTAGGGGG - Intergenic
1191937728 X:66443037-66443059 AGGAGGGAATGGGGAGAAGAGGG - Intergenic
1192912125 X:75616396-75616418 ATGAGGGGGTGGAGCCAAGATGG + Intergenic
1193711224 X:84882712-84882734 ATGAGGGAAAGGAGAGAGAAGGG + Intergenic
1194309163 X:92282111-92282133 ATAAGGGGAAGGAGAGAAAAGGG + Intronic
1194629342 X:96264502-96264524 GTGAAGACATGGTGAGAAGATGG - Intergenic
1195641936 X:107185012-107185034 ATCAAGGCATTGAGAGATGATGG + Intronic
1196200232 X:112878516-112878538 ATCAGGACATGGCAAGAAGAAGG + Intergenic
1196208399 X:112967423-112967445 ATGAGGGGCAGGAGACAAGAGGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1198097503 X:133394481-133394503 ATCAGGGCAAGGAGAAAAGAGGG + Intronic
1198499024 X:137224147-137224169 ATGAGGACATAATGAGAAGATGG + Intergenic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198945806 X:142012095-142012117 AGGAGGGCATTGAGAGTGGATGG - Intergenic
1199136927 X:144265277-144265299 AAGAAGGCATTGAGAGCAGATGG + Intergenic
1199589880 X:149457501-149457523 TTCAGGGCATCGAGAGAAGAGGG + Intergenic
1199770092 X:150969646-150969668 ATGAGGGAAAGGAGAGAAGGCGG + Intergenic
1199855178 X:151753803-151753825 ATGTGGCCATTGAGAGGAGAGGG - Intergenic
1199941685 X:152633767-152633789 ATGAGGGCAGGGTAAGCAGAAGG + Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201234934 Y:11900130-11900152 ATGAGGACACGTGGAGAAGATGG - Intergenic
1201670749 Y:16517546-16517568 ATGAGGACACAGGGAGAAGATGG - Intergenic
1201725337 Y:17144042-17144064 ATGAAGGCATGCAGAGTACAGGG + Intergenic