ID: 983534868

View in Genome Browser
Species Human (GRCh38)
Location 4:168846701-168846723
Sequence CGGAAGAAGCCTGCAGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983534868_983534872 8 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534872 4:168846732-168846754 AAGGGCTTTCTGAAAAGCTGAGG 0: 1
1: 0
2: 2
3: 26
4: 288
983534868_983534874 23 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534874 4:168846747-168846769 AGCTGAGGCTCTCAAAGTGTGGG No data
983534868_983534875 28 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534875 4:168846752-168846774 AGGCTCTCAAAGTGTGGGTATGG 0: 1
1: 0
2: 2
3: 11
4: 167
983534868_983534870 -10 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534870 4:168846714-168846736 GCTTCTTCCGAAGAATTAAAGGG No data
983534868_983534873 22 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983534868 Original CRISPR CGGAAGAAGCCTGCAGTTAG AGG (reversed) Intronic
904994873 1:34623765-34623787 GGGAAGAAGCGTGCAGATGGGGG + Intergenic
906210823 1:44011390-44011412 AGGAAGAAGCCTTCAGCTGGGGG - Intronic
908386353 1:63645916-63645938 CGTAAGAAGCACACAGTTAGTGG + Intronic
913485330 1:119328118-119328140 AGGAAGAAGCCTGGAGGTAGAGG - Intergenic
914680306 1:149934236-149934258 CGGAAGAAGCAGGCAGCCAGAGG - Exonic
916210263 1:162354576-162354598 AGGAAGACGCCTGCAGGAAGTGG - Intronic
917780119 1:178385833-178385855 GGGAAGAAGACTACAGGTAGAGG - Intronic
920605273 1:207377245-207377267 CTGAAGAAGTCTGCAGTAATAGG + Intergenic
1063826518 10:9904547-9904569 GGGAAGGAGCCTGCAGAGAGTGG - Intergenic
1064067431 10:12194715-12194737 CTGAAGAGGCCTGCAGTCGGTGG + Intronic
1078349627 11:10581866-10581888 AGGAAGAAGCCTACAGCAAGGGG - Exonic
1078466520 11:11554112-11554134 GGGAAGAAGCCGCCAGTCAGCGG - Intronic
1078541492 11:12217087-12217109 CCGAAGAAGCTTCCAGTCAGGGG - Intronic
1082941138 11:58706686-58706708 GGGAAGAAGCCAGCAGTCATAGG - Intronic
1085016855 11:73179324-73179346 AGAAAGAAGCCTGAAGTTGGGGG - Intergenic
1085655972 11:78315317-78315339 AGCAAGAAGCCTGCTTTTAGGGG + Intronic
1085942448 11:81221333-81221355 CGGAAGGTGCCTGGAGGTAGGGG + Intergenic
1089779105 11:120860627-120860649 CTCAGGAAGCTTGCAGTTAGTGG - Intronic
1091141431 11:133238605-133238627 GGGAAGAAGCCTGCACTTGCAGG - Intronic
1091811214 12:3399375-3399397 AGCAAGAAGGCTGCAGTTTGGGG + Intronic
1094310064 12:29070456-29070478 CATAAGAATGCTGCAGTTAGAGG - Intergenic
1095964620 12:47858546-47858568 AGGCAGAAGCCTGCAGGTGGTGG - Intronic
1104003252 12:124873889-124873911 CGGTAGAAGCCTGGAGGTAACGG + Intronic
1104914048 12:132255515-132255537 CAGATGAAGCCTCCAGGTAGCGG - Intronic
1107710557 13:43146494-43146516 CGGGAGTATCCTGCAGTTATTGG + Intergenic
1109307793 13:60660739-60660761 CGGAAGAAGCCTTCAGAAAGTGG - Intergenic
1110507383 13:76303443-76303465 AGCAAGATGCCTGCAGTGAGTGG - Intergenic
1110887404 13:80656368-80656390 TGGAAGAGGCCAGCAGTGAGAGG + Intergenic
1118510279 14:66464425-66464447 GTGAGGAAGCCTGCAGGTAGTGG - Intergenic
1120571546 14:86124023-86124045 GGGAAGAAGCCTGCGATTTGAGG + Intergenic
1122340325 14:101023886-101023908 TGGAGAAAGCCTGGAGTTAGAGG + Intergenic
1125492107 15:40155915-40155937 CAGCAGGAGCCTGGAGTTAGGGG - Intergenic
1129115935 15:73365497-73365519 CCCAGGCAGCCTGCAGTTAGTGG + Intronic
1129819061 15:78584105-78584127 CAGAAGAGGACTGCAGTCAGGGG + Intronic
1131311591 15:91295628-91295650 CTGGGGAAGCCTGCAGTTTGGGG + Exonic
1131329874 15:91487005-91487027 TGGAAGAAGCTTGCAGGTGGTGG + Intergenic
1133185798 16:4097375-4097397 CAGAACAAGCCTCCAGGTAGAGG - Intronic
1137063829 16:35815719-35815741 AGGAAGAAGACTGCAGTTTTGGG + Intergenic
1139404521 16:66707475-66707497 CTGAAGACGCCTGCAGTCCGTGG + Intergenic
1140712815 16:77694034-77694056 GGGAAGAAACCTGCAGGCAGAGG - Intergenic
1143121720 17:4611883-4611905 CGGGAGGAGCTTGCAGTGAGCGG + Intergenic
1147874686 17:43612794-43612816 GGGAAGTAGCCTGAAGTTTGCGG - Intergenic
1148736018 17:49865373-49865395 AGGTAGAAGCCTGCAGTCTGTGG - Intergenic
1162626458 19:11888545-11888567 CCCAAGAAGCCTGGAGTAAGTGG + Intronic
939941659 2:148358722-148358744 TGGATGAAGGCTGCAGTGAGCGG + Intronic
943350002 2:186785784-186785806 TGGAAGAAGCCTGCAGGGAGAGG + Intergenic
945030434 2:205658230-205658252 CTTAAGAACCCTGCAGTTATAGG + Intergenic
1168875667 20:1170680-1170702 TGCAAGAATCCTGCAGGTAGGGG - Intronic
1171405896 20:24912340-24912362 CAGATGAAGCCTCCAGGTAGCGG - Intergenic
1176065094 20:63190348-63190370 CGGCAGAAGCCGGCACTTGGGGG + Intergenic
1177925279 21:27206690-27206712 TGGCAGAAGCCGGCTGTTAGAGG + Intergenic
1184179059 22:42807066-42807088 AGGAAGCAGCCAGCAGGTAGGGG - Exonic
950269908 3:11605382-11605404 CAGAAGAAGTCTGCAGTCACTGG - Intronic
953016628 3:39083048-39083070 AAGAAGAAGCTTGCGGTTAGTGG + Intronic
953505423 3:43481645-43481667 CAGATGAAGCCTCCAGATAGTGG - Intronic
953707555 3:45242915-45242937 GTGAAGCAGCCAGCAGTTAGTGG + Intergenic
955867101 3:63396749-63396771 CTCAAGAAGCCTGAAGTTATAGG - Intronic
956882083 3:73520799-73520821 AGGAAGAAACCTGAAGCTAGGGG + Intronic
961794299 3:129398586-129398608 CAGAGGAAGCCTCCAGGTAGCGG - Intergenic
962178961 3:133185450-133185472 CGGGAGAAGCCTGTAGGTACTGG - Intronic
963504141 3:146163213-146163235 CGGAGGGAGCTTGCAGTGAGGGG - Intronic
964296565 3:155240134-155240156 CGGAAGAGGCCAGCAGACAGGGG + Intergenic
970654262 4:18213639-18213661 TGGAAGAGGCCAGCAGATAGCGG + Intergenic
971379145 4:26080996-26081018 CGGGAGACGCCTGGAGTTAGGGG + Intergenic
983534868 4:168846701-168846723 CGGAAGAAGCCTGCAGTTAGAGG - Intronic
985099218 4:186441707-186441729 CTGAAGAAGCCTGGAGCTAGGGG + Intronic
986231344 5:5867175-5867197 GGGAAGAAGCCTGGAGTTGAAGG - Intergenic
986271670 5:6236485-6236507 AGGAAGAAGTCTGCAGGCAGAGG + Intergenic
986512356 5:8521571-8521593 GGGAAGAAGACTGAATTTAGTGG - Intergenic
988254731 5:28807783-28807805 CTGAACAACCCTGGAGTTAGGGG + Intergenic
996682403 5:126242293-126242315 CAGAAAAAGCCTAGAGTTAGAGG - Intergenic
996688450 5:126310677-126310699 GAGAAGATGCCTCCAGTTAGAGG - Intergenic
1003425107 6:5993970-5993992 GGGTAGTAGCCTGCAGTAAGAGG + Intergenic
1005597627 6:27394523-27394545 AGGCAGAAGCCTGCTGTAAGGGG + Intronic
1005603989 6:27456941-27456963 AGAAAGAAACCTGCAGTAAGGGG + Intronic
1010114742 6:72290148-72290170 CGAAAGAAGCCTGCCTTTTGAGG - Intronic
1019041804 6:169112107-169112129 CAGATGAAGCCTCCAGGTAGCGG - Intergenic
1022201201 7:28119417-28119439 CAGAAGATGCCTGCAGTCTGAGG - Intronic
1022717980 7:32915850-32915872 TGGAAGAAGGCTTCAGTAAGAGG + Intergenic
1028103455 7:86849279-86849301 AGAAAGGAGCCTGCAATTAGGGG + Intronic
1029740588 7:102489356-102489378 AGTAAGAAGCCTGCAGCTGGAGG - Intronic
1029758585 7:102588528-102588550 AGTAAGAAGCCTGCAGCTGGAGG - Intronic
1029776523 7:102687607-102687629 AGTAAGAAGCCTGCAGCTGGAGG - Intergenic
1030724679 7:112912831-112912853 AGGAAGAAGACTGAAGTTTGAGG + Intronic
1031814466 7:126415949-126415971 TGCGATAAGCCTGCAGTTAGGGG + Intergenic
1032506266 7:132436871-132436893 CTGAAGCAGCCTGCATTGAGTGG - Intronic
1033626984 7:143119992-143120014 CTGATGAAGCCTCCAGGTAGCGG + Intergenic
1046938920 8:119912478-119912500 CGGAGGCAGCTTGCAGTTAAGGG - Intronic
1048384312 8:133897571-133897593 AGGAAGCTGCCTGCTGTTAGGGG + Intergenic
1049030241 8:140030828-140030850 CGGCAGTTGCCTGGAGTTAGAGG + Intronic
1049766463 8:144357581-144357603 CGGAAGGAGCCTGGAGCCAGGGG + Intronic
1055012863 9:71586249-71586271 AGGAAGAAGCCTGCAGTATAAGG - Intergenic
1056652522 9:88479503-88479525 TGGAAGAAGGCTGCAGTTCAAGG + Intergenic
1059218364 9:112588815-112588837 AGGAAGAAACATGAAGTTAGGGG - Intronic
1186801834 X:13100491-13100513 TGGAAGAAGCCTGGAGTAGGAGG + Intergenic
1192263611 X:69523909-69523931 AGGAAGAACCCTGGAGTTGGAGG + Intronic
1193047565 X:77068840-77068862 TGCAAGAAACCTCCAGTTAGGGG + Intergenic
1198113792 X:133525429-133525451 CCAGAGAAGCCTGTAGTTAGTGG - Intergenic
1200087012 X:153611906-153611928 CGGAAGCAGGCTGCCCTTAGGGG - Intergenic
1200147803 X:153935395-153935417 TGGAAGCAGCCTGCGGGTAGAGG + Exonic
1201757562 Y:17502717-17502739 CTCAAGAAGCCTGCAGTCTGAGG - Intergenic
1201843992 Y:18403265-18403287 CTCAAGAAGCCTGCAGTCTGAGG + Intergenic