ID: 983534871

View in Genome Browser
Species Human (GRCh38)
Location 4:168846721-168846743
Sequence CAGAAAGCCCTTTAATTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983534871_983534875 8 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534875 4:168846752-168846774 AGGCTCTCAAAGTGTGGGTATGG 0: 1
1: 0
2: 2
3: 11
4: 167
983534871_983534877 23 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534877 4:168846767-168846789 GGGTATGGTACCCACACTGGTGG 0: 1
1: 0
2: 1
3: 3
4: 121
983534871_983534874 3 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534874 4:168846747-168846769 AGCTGAGGCTCTCAAAGTGTGGG No data
983534871_983534873 2 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG No data
983534871_983534876 20 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534876 4:168846764-168846786 TGTGGGTATGGTACCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983534871 Original CRISPR CAGAAAGCCCTTTAATTCTT CGG (reversed) Intronic
902641238 1:17767611-17767633 CAGTAAGCCCTTTGCTTTTTGGG + Intronic
904149227 1:28423194-28423216 CAGAAAGGCCTTGAACTCCTGGG - Intronic
908081931 1:60590141-60590163 AGAAAAGCCCTTTAATCCTTTGG + Intergenic
909140118 1:71853667-71853689 CAGAAAGCCTGTAAATTCATAGG - Intronic
910021842 1:82600590-82600612 CAGAAATCTCTATAAGTCTTAGG - Intergenic
910651002 1:89566932-89566954 CAGAATACCCTTTTATTTTTAGG + Intronic
911016101 1:93334379-93334401 CAGCCTGCCCTTTAATTTTTTGG + Intergenic
911584580 1:99676171-99676193 CCAAATGCCCTTTAATTCTCTGG + Intronic
912217608 1:107633495-107633517 CACAAAACCATTTTATTCTTAGG + Intronic
912868592 1:113282226-113282248 CACAAAGCCATTAATTTCTTTGG + Intergenic
913106371 1:115617426-115617448 CAAAAAGCCCTTTACTCCTAGGG + Intergenic
915800948 1:158792901-158792923 CAGAAACACCTATAATTATTAGG + Intergenic
917214281 1:172662120-172662142 CAGAAGGACATTTAATGCTTTGG + Intronic
917620251 1:176788218-176788240 CAGATATCACTTTAGTTCTTGGG + Intronic
918645631 1:186901351-186901373 CAGAATGCTCTTGCATTCTTGGG + Intronic
918721707 1:187860614-187860636 CAGGAAGGCCTATTATTCTTAGG + Intergenic
919319190 1:196013044-196013066 CAGAAATACGTTAAATTCTTCGG + Intergenic
919401605 1:197125281-197125303 CATAAAGCCCTGTAACTGTTGGG - Intronic
919491254 1:198208331-198208353 CAGAAATCACTTTAATTTTAGGG + Intronic
919491940 1:198214698-198214720 CAGAAATAACTATAATTCTTAGG - Intronic
922128064 1:222748822-222748844 CAGAAAGTCCTATAATTCAGGGG + Intronic
924192032 1:241563670-241563692 AAGAAAGCCCTTTATTTTCTAGG + Intronic
924646227 1:245879557-245879579 CAGAAAGCTACTCAATTCTTAGG + Intronic
1068805271 10:61188215-61188237 CACAAAGCTCTTTAATTACTTGG + Intergenic
1072380204 10:94859843-94859865 GAGAAAGACCTCTAATTCATTGG + Intergenic
1072391727 10:94994157-94994179 CTGAAAGACCTTTAGTTCTGAGG + Intergenic
1073780227 10:106829973-106829995 CTAAAAACTCTTTAATTCTTTGG - Intronic
1078488293 11:11744232-11744254 CAGAAAGACGAGTAATTCTTCGG - Intergenic
1079929421 11:26539474-26539496 CAAAAAGCCTTTTAATCTTTGGG + Intronic
1079936503 11:26623179-26623201 CAGATAACACTTTAACTCTTAGG + Intronic
1081093205 11:38898593-38898615 AAGAAAGACCTTTAATTTTGAGG + Intergenic
1083731800 11:64656283-64656305 CCCAAAGCCCTTTAATCCCTGGG - Intronic
1084516447 11:69640460-69640482 CTGAAATCCCTTTAACTTTTAGG + Intergenic
1085069145 11:73526395-73526417 AAGAAAGCCCTTTTATTTTTAGG - Intronic
1085886015 11:80522895-80522917 CATTGAGCCCCTTAATTCTTGGG - Intergenic
1086033648 11:82390588-82390610 CTGAAACCACTTTAATTCTGAGG + Intergenic
1088369638 11:109075142-109075164 CCCAAAGCCCTTCAGTTCTTAGG - Intergenic
1088370966 11:109088320-109088342 CAGAAAGCCCATTACATCTGTGG - Intergenic
1093322847 12:17736040-17736062 CAGAAAGCACTTAATTTCTTGGG + Intergenic
1095048976 12:37540832-37540854 CAGAAACCTCTTTAATCCTCTGG + Intergenic
1097606952 12:61767242-61767264 CAGAAAGCACTTTACTTATTTGG + Intronic
1100049583 12:90430994-90431016 CAGGAATGTCTTTAATTCTTGGG + Intergenic
1101472851 12:105014934-105014956 CAGATAGTCCTTAAATTCTCAGG - Intronic
1102273891 12:111564711-111564733 CAGACTGGCCTTTAATTCCTGGG - Intronic
1109937203 13:69303168-69303190 CACAAAGCATTTTAAATCTTTGG - Intergenic
1110279382 13:73675211-73675233 CAAGAAGCCCTTTACTTCTCAGG + Intergenic
1112122859 13:96432214-96432236 CAGAAAGCCCTTCAAAACTATGG + Intronic
1112439123 13:99412844-99412866 CAGAAAGCCCTTTGAACCTCAGG + Intergenic
1112779820 13:102887607-102887629 TTGAAATCCCTTTAATTCTGAGG + Intergenic
1115100411 14:29691468-29691490 CAGAAAGCCCTTAATGTCATGGG - Intronic
1117426225 14:55600504-55600526 CATAAACCCCTTTTATTCTTTGG - Intronic
1118021692 14:61722784-61722806 GAGTAAGACCTCTAATTCTTAGG + Intronic
1120384742 14:83830125-83830147 CAGAATGAGGTTTAATTCTTAGG + Intergenic
1124422214 15:29532802-29532824 GAGAATTGCCTTTAATTCTTGGG - Intronic
1125346333 15:38722812-38722834 CAGAAAACCATGTAATTCTTCGG + Intergenic
1127592458 15:60439272-60439294 AAGAAAACACTTTAATTTTTTGG - Intronic
1127738608 15:61873249-61873271 CAGAAAGCCCTTTCCTCCTCTGG + Exonic
1129281124 15:74485837-74485859 CAAAAAGTGCTTTAAGTCTTTGG - Intergenic
1130984224 15:88834261-88834283 CAGACAGCCCTTTCATTTCTGGG + Intronic
1135012650 16:18895749-18895771 CAGCAAGTCCTTGAACTCTTGGG - Intronic
1135319564 16:21483311-21483333 CAGCAAGTCCTTGAACTCTTGGG - Intergenic
1135372401 16:21914800-21914822 CAGCAAGTCCTTGAACTCTTGGG - Intergenic
1135439385 16:22455904-22455926 CAGCAAGTCCTTGAACTCTTGGG + Intergenic
1136329797 16:29565030-29565052 CAGCAAGTCCTTGAACTCTTGGG - Intergenic
1136444425 16:30304734-30304756 CAGCAAGTCCTTGAACTCTTGGG - Intergenic
1136740758 16:32522593-32522615 TAGAAACCCCTTTAATTAATGGG - Intergenic
1137296735 16:47101285-47101307 CATAAATCCCTCTAATTATTTGG - Intronic
1138107268 16:54294846-54294868 CAGCAACCCCTTGCATTCTTTGG - Intergenic
1138258420 16:55592430-55592452 CAGGAAACCCCTTAAGTCTTTGG - Intergenic
1140089756 16:71828052-71828074 CAAAAAGCTATATAATTCTTTGG + Intergenic
1142336839 16:89494842-89494864 CAAAAAGCTCTTAAATTCTCAGG + Intronic
1203028844 16_KI270728v1_random:552641-552663 TAGAAACCCCTTTAATTAATGGG + Intergenic
1203042877 16_KI270728v1_random:781790-781812 TAGAAACCCCTTTAATTAATGGG - Intergenic
1144491384 17:15713750-15713772 CAGAAAAGCCTTTAAGTTTTAGG + Intronic
1144909101 17:18665453-18665475 CAGAAAAGCCTTTAAGTTTTAGG - Intronic
1146193839 17:30794318-30794340 CAGAACCCCCATTAATTTTTAGG + Intronic
1148590368 17:48812000-48812022 CAGAAAGCATTTTAATTCCCTGG + Intronic
1149915434 17:60604218-60604240 CAGAAAACTCTTTAAATATTGGG + Intronic
1150428194 17:65093963-65093985 CAGAATCCCCTTCAATTCTGGGG + Intergenic
1152481093 17:80553508-80553530 CAGAAACATCTTTAAGTCTTGGG - Intronic
1154017961 18:10637270-10637292 TATAAAGCCATTTATTTCTTTGG + Intergenic
1154383646 18:13874045-13874067 CAGAAAATCCATTAATTCTCCGG - Intergenic
1155123278 18:22844157-22844179 CAGTAACACCTTTAATTCTGTGG + Intronic
1155211188 18:23603665-23603687 CAGAAAAGCCTTTAAGTTTTGGG + Intronic
1155438291 18:25835283-25835305 CAGATACTCATTTAATTCTTTGG - Intergenic
1155844601 18:30689845-30689867 CAGAAATCCTTACAATTCTTTGG + Intergenic
1157760808 18:50263849-50263871 CAGGAAGCCTTTTAAGGCTTGGG + Intronic
1157916777 18:51671410-51671432 CAGGAAGCCCTTTTAATCTGGGG - Intergenic
1160293717 18:77618493-77618515 CAGATAGCCTCTAAATTCTTGGG + Intergenic
1162685586 19:12381036-12381058 TAGGAAGTCCTTCAATTCTTTGG - Exonic
1164390256 19:27813676-27813698 CAGAATGCTCTTTTATTCTCTGG + Intergenic
1164496229 19:28765243-28765265 CAGAAATACCTTTTGTTCTTGGG - Intergenic
1166267346 19:41692887-41692909 CAGAAATACCTATAATTCCTAGG + Intronic
1166521017 19:43480056-43480078 CAGGCTGCCCTTGAATTCTTAGG - Intronic
926079532 2:9973168-9973190 CTGAAAGTCTTTTATTTCTTGGG + Intronic
927155088 2:20216711-20216733 CAGAAAGCCCTTTAGAACTTGGG - Intronic
927815213 2:26209845-26209867 CATCAAGGCCTTTGATTCTTTGG + Exonic
927835196 2:26391475-26391497 CTGAAAGACCTTTCATACTTTGG - Exonic
930022189 2:47008168-47008190 CAGAAAGCCCGTCTAATCTTGGG + Intronic
930344379 2:50160541-50160563 CAGAAAGCCATTTTTTTTTTTGG - Intronic
931233284 2:60392159-60392181 CAGAAAGCTCTAAAAATCTTGGG + Intergenic
931843250 2:66176641-66176663 AAGATATCCATTTAATTCTTTGG + Intergenic
933321610 2:80782004-80782026 TAGAAAGAGCTTTAATTGTTTGG + Intergenic
933665007 2:84957790-84957812 CAGAGAGCCCTCTGATCCTTTGG + Intergenic
933945284 2:87280958-87280980 CAGCAAGTCATTTAACTCTTTGG + Intergenic
934083739 2:88491837-88491859 CTGAAATCCATTTAATTCTAAGG - Intergenic
935151659 2:100442351-100442373 CTGAAAGCCCTTCTATTCCTAGG - Intergenic
936334923 2:111580633-111580655 CAGCAAGTCATTTAACTCTTTGG - Intergenic
937146478 2:119649720-119649742 CAGAAAGTTCTGTAATGCTTAGG - Intronic
937953438 2:127405812-127405834 CAGAAAGACCTTAAATGCTCTGG + Intergenic
940378148 2:152981133-152981155 CAGAAAGACATTTAATACTTAGG - Intergenic
943662964 2:190578612-190578634 CAGAAAGCCCTGTACTGCCTGGG + Intergenic
947126787 2:226877381-226877403 CAGAAAACTCTTTAAGTATTGGG + Intronic
947318406 2:228890031-228890053 CACTAATTCCTTTAATTCTTAGG + Intronic
1170609060 20:17896694-17896716 CAGAATGTCCTTTACTTTTTAGG + Intergenic
1171543517 20:25984334-25984356 CAGAAACCTCTTTAATCCTCTGG + Intergenic
1176894314 21:14358384-14358406 CAGAAATCTGTTTAATTCATTGG - Intergenic
1178118071 21:29437530-29437552 CAGAAAGCTTTTTTATTATTTGG - Intronic
1180598146 22:16993257-16993279 CAGTAAGCCATTTACCTCTTTGG + Intronic
1184739414 22:46418803-46418825 CACAAAGCCTTTTATTTCTCAGG + Intronic
949609961 3:5693797-5693819 CTGAAAGACCTTTAGTTCTGAGG + Intergenic
951408707 3:22334354-22334376 TAGAAAGCCCTTTGATTCTTAGG - Intronic
951701233 3:25498600-25498622 CATAAAGTTCTTTAATTCTCTGG + Intronic
951839018 3:27013646-27013668 GGGGAAGCCCTTTAATTCTCAGG + Intergenic
952563649 3:34628113-34628135 CAAAAAATCCTTTAATTCCTTGG - Intergenic
953636782 3:44671011-44671033 GAGAAAACCCTTTGGTTCTTTGG - Intergenic
956297312 3:67728595-67728617 CAGACAGCTCTTTCATTCCTTGG + Intergenic
958038687 3:88200214-88200236 CAGAAAAGCCTTTAAGTATTAGG + Intergenic
960021974 3:112965200-112965222 CACAAAGCTTCTTAATTCTTAGG - Intronic
960829149 3:121826827-121826849 CAGAAAAACCTTTTATTATTGGG - Intronic
963916474 3:150863192-150863214 CAGAAAAGCCTTTAAGTATTGGG - Intergenic
966095251 3:176192755-176192777 CAGAAAGACATTTAATAATTTGG - Intergenic
966645930 3:182246296-182246318 CAGCAAGTCCTCTACTTCTTTGG + Intergenic
967756758 3:193178713-193178735 CAGAAAACCCTTTAATAGATAGG - Intergenic
968079498 3:195836235-195836257 CATAAATCCCTGTAATTCTAGGG + Intergenic
968204288 3:196785315-196785337 CTGAATGACCTTTAAATCTTTGG - Intronic
970620072 4:17809522-17809544 CAGAAAATCCATTACTTCTTCGG + Intronic
971862318 4:32123702-32123724 CACAACGCACTGTAATTCTTTGG + Intergenic
974621970 4:64368065-64368087 CAATAAGCCCTTTTATTATTGGG - Intronic
975077980 4:70236926-70236948 CAAAAAGCTCTGTAATTTTTTGG - Intergenic
976586340 4:86801191-86801213 AAGAATTCCCTTGAATTCTTTGG - Intronic
976994033 4:91407416-91407438 CAGTAAGTCCTTGAACTCTTAGG - Intronic
977687579 4:99866212-99866234 CAGACATCTCTTTGATTCTTGGG - Intronic
979085453 4:116404619-116404641 CGGGCAGCCCTGTAATTCTTGGG - Intergenic
981047587 4:140279630-140279652 CAGCAGGCCTTTTTATTCTTAGG - Intronic
982491882 4:156039723-156039745 CAGGAACCCCTGTTATTCTTAGG - Intergenic
983256414 4:165405343-165405365 CATCAAGGCCTTTGATTCTTTGG + Intronic
983534871 4:168846721-168846743 CAGAAAGCCCTTTAATTCTTCGG - Intronic
983692735 4:170492022-170492044 CAGTAAGACCTCTAATTCATTGG + Intergenic
984233375 4:177127478-177127500 CAGAAATACCTTTAATTATATGG - Intergenic
984807569 4:183765676-183765698 CAAAGAGCCCTTTCATTCTTGGG - Intergenic
986803666 5:11287316-11287338 CAGAATCCCCTTTACTTCTAAGG - Intronic
987350743 5:17019738-17019760 CATACAGCCCTTTTATTCATTGG - Intergenic
991306462 5:65181367-65181389 CAGAAATCCTCTTAAGTCTTTGG - Intronic
991591869 5:68260216-68260238 CTGAGAGTCATTTAATTCTTTGG - Intronic
995496699 5:112752828-112752850 CAGAAAGAACTTTAATGATTGGG + Intronic
995792570 5:115906625-115906647 CAGGGAGTCCTTTTATTCTTAGG - Intronic
997053517 5:130412189-130412211 TTTAAAGCTCTTTAATTCTTAGG + Intergenic
997280004 5:132636215-132636237 CAAAAAGCCCTTAGGTTCTTTGG - Intronic
997303886 5:132824936-132824958 TAGGAAGCCCTTTCATTTTTTGG + Intronic
998268654 5:140686537-140686559 TAGAAAACTCTTTAATTATTGGG + Intronic
999520562 5:152346657-152346679 CAGAAAGCCCTTTCATAGATGGG - Intergenic
999970912 5:156861505-156861527 TAAAAAGACCATTAATTCTTTGG - Intergenic
1000966760 5:167666922-167666944 CAGAAACCCCTTTCAGTCTCAGG - Intronic
1003240750 6:4343791-4343813 CAGAGGGCCTTTTAATTATTGGG + Intergenic
1003252413 6:4441880-4441902 CCTACAGCCCTTTAATTCCTGGG - Intergenic
1003901027 6:10655668-10655690 CAGAAAGCCCTCCAAGTCCTAGG + Intergenic
1005398588 6:25408420-25408442 CAGGAAGCCTTTGAATTCTTCGG - Intronic
1007740968 6:44009280-44009302 CAGAAAGGGCTTTCTTTCTTGGG - Intergenic
1008149376 6:47931933-47931955 AAGGAAGCCCTTTAGTCCTTGGG - Intronic
1008706529 6:54167163-54167185 CAGAAAACCTTTTAAAGCTTAGG + Intronic
1010588405 6:77682989-77683011 CTGAAAGCCCTTTAAAATTTCGG + Intergenic
1011754037 6:90481135-90481157 GAGGAAGCCATCTAATTCTTGGG - Intergenic
1012707756 6:102554570-102554592 CAGAAACCTTTTTAATACTTAGG + Intergenic
1013992259 6:116266690-116266712 CACAAAGCTTTCTAATTCTTAGG - Intronic
1015342404 6:132116583-132116605 CAGAAAGAATTTTATTTCTTTGG + Intergenic
1015847985 6:137541808-137541830 GTGTAAGCCCTTTTATTCTTTGG + Intergenic
1018096781 6:160394506-160394528 CATCAAGCCCTTCAATCCTTGGG + Intronic
1020583508 7:10034651-10034673 GAGCAAGCCATTTAATTCTTAGG - Intergenic
1020674789 7:11169479-11169501 CAGAAAATCTTTTATTTCTTTGG - Intronic
1022811153 7:33870121-33870143 AAGACAGACCTTTATTTCTTTGG + Intergenic
1027954174 7:84858362-84858384 CAGAAAGCAATTTAATTCCTGGG - Intergenic
1028017822 7:85737328-85737350 CAGGAAGACCTATGATTCTTAGG - Intergenic
1030275906 7:107721580-107721602 TTTCAAGCCCTTTAATTCTTTGG - Intergenic
1031313153 7:120224860-120224882 CAGAAAACAATTTAATACTTTGG + Intergenic
1032022003 7:128412265-128412287 CAGACAGTCCTTTAAATTTTAGG - Intergenic
1033143854 7:138853776-138853798 CAGATTTCCCTTTAATTATTTGG - Intronic
1033389026 7:140908423-140908445 GAGAAAGGCCTTTCATTCTAGGG - Intronic
1033582050 7:142747204-142747226 CAGAAAATCCTCAAATTCTTGGG + Intergenic
1036825667 8:11974046-11974068 CAGAAAGCCGTATGTTTCTTCGG - Exonic
1036920426 8:12848542-12848564 CAGAAATTCATTTATTTCTTTGG + Intergenic
1037577774 8:20224178-20224200 CAGAAAGCCCTTCAGTTATCAGG - Intronic
1038143026 8:24866834-24866856 TAGACAGCACTTTAATGCTTGGG - Intergenic
1038163493 8:25062715-25062737 CAGAAAGGCCTTCTACTCTTCGG + Intergenic
1039720682 8:40161020-40161042 GAGACAGCCCTTACATTCTTTGG - Intergenic
1045739069 8:105332929-105332951 CACAAAGCCCTTTAAAAGTTTGG - Intronic
1048423017 8:134295623-134295645 CCCAAAGCCCTTTAAAGCTTTGG - Intergenic
1048854221 8:138672984-138673006 CAAAAATCCCTTTAATCTTTAGG - Intronic
1050487424 9:6148833-6148855 CAGAAAGGGCTCTAATTGTTTGG - Intergenic
1051684993 9:19649020-19649042 CAAAAAACCCAGTAATTCTTTGG + Intronic
1052460193 9:28753072-28753094 CAGAAAGCTTTTTCATTCTGTGG + Intergenic
1056029582 9:82538799-82538821 CAGAAAGCCTTATAATTGCTTGG - Intergenic
1059622918 9:116028323-116028345 CTAAAAGCACTTTAATGCTTTGG - Intergenic
1060082515 9:120663775-120663797 CTTTCAGCCCTTTAATTCTTTGG + Intronic
1061238438 9:129355410-129355432 CAGACAGGCATTTAGTTCTTTGG - Intergenic
1185875428 X:3698131-3698153 CTGAAAACACTCTAATTCTTTGG - Intronic
1186027846 X:5333347-5333369 CAGGCAGATCTTTAATTCTTGGG + Intergenic
1186556238 X:10561878-10561900 CAGAATGCTCTATAATCCTTTGG - Intronic
1188391578 X:29627341-29627363 CAGAAAGCCATTTATTAATTAGG + Intronic
1189665880 X:43354374-43354396 TAGAAAGGACTTTAATTATTTGG - Intergenic
1190460911 X:50673766-50673788 CTGAATGCCATTTATTTCTTTGG - Intronic
1192631890 X:72783569-72783591 CAGACAGCCCTGTGATTCATAGG + Intronic
1192649819 X:72937232-72937254 CAGACAGCCCTGTGATTCATAGG - Intronic
1193037955 X:76973736-76973758 CAGAAAGCTCTTTCATGCTGTGG + Intergenic
1194047887 X:89032051-89032073 CAGAAATGCCTATGATTCTTAGG + Intergenic
1195293582 X:103453180-103453202 CAGTATGTCCTTTACTTCTTTGG + Intergenic
1197027964 X:121778329-121778351 CAGAAACCACTATAATCCTTGGG + Intergenic
1197627266 X:128816031-128816053 CAGAAAACGCTATAATTCTTTGG - Intergenic