ID: 983534873

View in Genome Browser
Species Human (GRCh38)
Location 4:168846746-168846768
Sequence AAGCTGAGGCTCTCAAAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983534868_983534873 22 Left 983534868 4:168846701-168846723 CCTCTAACTGCAGGCTTCTTCCG 0: 1
1: 0
2: 0
3: 5
4: 96
Right 983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG No data
983534871_983534873 2 Left 983534871 4:168846721-168846743 CCGAAGAATTAAAGGGCTTTCTG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983534873 Original CRISPR AAGCTGAGGCTCTCAAAGTG TGG Intronic
No off target data available for this crispr