ID: 983544986

View in Genome Browser
Species Human (GRCh38)
Location 4:168953460-168953482
Sequence TTGTGCCACTGCAAAGGCAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983544986_983544988 16 Left 983544986 4:168953460-168953482 CCGTTGCCTTTGCAGTGGCACAA 0: 1
1: 0
2: 0
3: 21
4: 204
Right 983544988 4:168953499-168953521 CTGCAGCCTCTCAACGTCTCTGG 0: 1
1: 0
2: 6
3: 30
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983544986 Original CRISPR TTGTGCCACTGCAAAGGCAA CGG (reversed) Intronic
900760697 1:4468255-4468277 TCCTGCCACTGCAAATCCAAGGG - Intergenic
901945964 1:12703958-12703980 TTTTGGCACTGCAAAAGAAATGG + Intergenic
902878568 1:19355803-19355825 TTGTGGCACTGCACTGGCACAGG + Intronic
905472160 1:38201444-38201466 CTGTGCCTCTGTAAAGGCAGGGG + Intergenic
905527666 1:38651299-38651321 CTGAGCCACTGCAGAGGCTAAGG + Intergenic
910478999 1:87638156-87638178 TTGAGTCACTGCCATGGCAAGGG - Intergenic
910812651 1:91253817-91253839 TAGTACCACTGCAGAGGCAATGG - Intergenic
912213164 1:107577375-107577397 TGGTGCCACTGCAATGGAAAAGG + Intronic
913211872 1:116589097-116589119 CTTTGTCACTGCAAAGGAAAGGG + Exonic
914925128 1:151878441-151878463 TTGTGCCACTACACTGGGAAAGG + Intronic
916409622 1:164533004-164533026 TTGTGAAACTGAAAAGGCATTGG - Intergenic
917149391 1:171928667-171928689 TAGTTCCACTGCAGAGGCAGTGG + Intronic
917173290 1:172201693-172201715 CAGTTCCACTGCAAAGGCAATGG + Intronic
917512742 1:175681749-175681771 TTGAGCAACTGCAGAGGGAAGGG + Intronic
918647128 1:186917895-186917917 TTGTGCTACTGCTTTGGCAAAGG + Intronic
918704016 1:187638882-187638904 TTGGGGCACAGCAAAGGGAAAGG - Intergenic
919070780 1:192752199-192752221 CTGTGACACCGCAAATGCAAAGG + Intergenic
922134376 1:222810472-222810494 TTGTTTCTCTGCAAAAGCAATGG - Intergenic
922543418 1:226435906-226435928 TTGTGACACAGAAAGGGCAAAGG - Intergenic
1068489245 10:57701073-57701095 TTATGCCACTTCAAAGGGAGAGG + Intergenic
1069046940 10:63752949-63752971 TTGTGCCACTACAAAAGCCCGGG - Intergenic
1070998208 10:80805458-80805480 TTGGGGCACAGCAAAAGCAAGGG - Intergenic
1074604092 10:114943178-114943200 TTGTTCCACTGCTAAGGCAGAGG + Intronic
1076105859 10:127823211-127823233 CAGTGCCACTGCCAAGGCAGAGG - Intergenic
1076590064 10:131576839-131576861 CTGTGCCACTGCAATGGGGATGG - Intergenic
1076818133 10:132924591-132924613 TTGTGGCACTGTCATGGCAAGGG + Intronic
1077453755 11:2665817-2665839 TTGTGCCAGTGCTGAGGCACAGG + Intronic
1078629786 11:12991829-12991851 TTGGGCCACTGCATATGCAGTGG - Intergenic
1079303961 11:19306037-19306059 ATGTGCCTCTCCAAAGGAAATGG + Intergenic
1080042305 11:27771636-27771658 TTCTGACAATGCAAAGGCAAAGG + Intergenic
1084169296 11:67392789-67392811 TAGTGCCACTGCTGAGGGAAGGG - Intronic
1085091511 11:73719185-73719207 TTTTGCCACTTGAAAGGCATAGG - Intronic
1086420147 11:86630808-86630830 GTGTGGCACTGCACAGGCACTGG - Intronic
1088401148 11:109423377-109423399 TGGTGCCTCTGCAAAGGAAAGGG + Exonic
1090638247 11:128707098-128707120 TTGGGCGATAGCAAAGGCAAGGG + Intronic
1094765384 12:33588600-33588622 TTGTGACACTGAACAGGAAAAGG + Intergenic
1098653168 12:73000580-73000602 TTGTGAGACTGCAAAGGCATAGG - Intergenic
1098699201 12:73602097-73602119 ATGTATCACTGCAAAGACAAGGG - Intergenic
1098748698 12:74269515-74269537 TTGTGCTACTGCTCTGGCAAAGG - Intergenic
1102324462 12:111967942-111967964 TTATGCCACAGCACAGGAAATGG + Intronic
1104767712 12:131341119-131341141 TGGTGCCATTTCAAAGACAAAGG - Intergenic
1105215126 13:18279723-18279745 CTTTGTCACTGCAAAGGAAAGGG + Intergenic
1109918723 13:69027211-69027233 TTGCGGCACTGGAGAGGCAATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1113467593 13:110523330-110523352 TTCTGCCTCTGCAAGGGCAAGGG + Exonic
1116049408 14:39784949-39784971 TTTTGCTACAGCAAAGGCACTGG + Intergenic
1117535346 14:56697591-56697613 TTGTGCCACTGCATAAGCCTGGG - Intronic
1119909873 14:78339891-78339913 TTGTGTCACTGAAAAGGAGAAGG - Intronic
1122071486 14:99208206-99208228 TTGTGCCACTCCAAAGGACAAGG - Intronic
1124133437 15:27010757-27010779 TAGTGGAACGGCAAAGGCAATGG - Intronic
1124943918 15:34245378-34245400 TTTGGCCACAGCAAAGCCAATGG - Exonic
1125025125 15:35021967-35021989 TTGTGTTATTGCAAAGGAAAGGG + Intergenic
1125999154 15:44193919-44193941 TTTTCCTGCTGCAAAGGCAAAGG + Intronic
1127096246 15:55514646-55514668 TTGTGCTACTGCTTTGGCAAGGG + Intergenic
1127774339 15:62253706-62253728 TTATGCCACTGCAAGGGAGAAGG - Intergenic
1131451398 15:92543228-92543250 CTGTGTCACTGAAAAGGCATAGG - Intergenic
1133654586 16:7848407-7848429 TTGTTCAAGTGCAGAGGCAAAGG + Intergenic
1135671808 16:24381987-24382009 ATGGGGCACAGCAAAGGCAAGGG + Intergenic
1138789484 16:59886306-59886328 TTGTTCCACTTCTAAGACAAAGG + Intergenic
1138997356 16:62472122-62472144 TAGTACCACTGCAACGGCAGTGG + Intergenic
1140593939 16:76386355-76386377 GTGTACCACTGAGAAGGCAAAGG - Intronic
1146751893 17:35389467-35389489 TAGTACCACTGCAGAGGCAGTGG + Intergenic
1148507238 17:48137242-48137264 TTCTTCCACTTCAAAGGCAGTGG + Exonic
1149896728 17:60434071-60434093 TGGTGACATTGCCAAGGCAACGG - Intergenic
1150509284 17:65732377-65732399 TTGTTCCACTGAAAAAGCACAGG + Intronic
1151528586 17:74688878-74688900 TTGTGCTTCAGGAAAGGCAATGG + Intronic
1151661418 17:75521206-75521228 ATGTGCCTCTGCCTAGGCAATGG - Intronic
1152011360 17:77720603-77720625 TTAGGCCACTGCAAAGGTAGTGG + Intergenic
1157763747 18:50282732-50282754 TTGTACCACTGCCAAGGGAGCGG + Exonic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1164608034 19:29613856-29613878 TTTTGTCACTGCAAAGAAAAAGG - Exonic
1164614766 19:29660390-29660412 TTGTGCCACTACCCAGGCAGTGG - Intergenic
1164938424 19:32232511-32232533 TTTTGCCCCTGCAAGGGCGAGGG + Intergenic
1165642137 19:37398673-37398695 TTGAGCCACAGCAGAGGCAGCGG + Intergenic
1168056048 19:53866028-53866050 ATGTGCTTCTGCAAAGGGAAGGG - Intergenic
1168209777 19:54881998-54882020 CTCTGCCACTGCCATGGCAAGGG - Intronic
1168445236 19:56405963-56405985 TTATGCCACTTCATAGGTAATGG + Intronic
927446334 2:23165363-23165385 TAGTGCCAATGCCAAGGCAGGGG + Intergenic
927727388 2:25436960-25436982 TTGAGTAACTGCAAAGCCAAGGG + Intronic
927932216 2:27052285-27052307 TGGTGCCTCTGCCAAGCCAAAGG - Intronic
928095520 2:28402487-28402509 TTGTGACAAGGCAAAGACAATGG + Intronic
928285899 2:29989764-29989786 TTTTCCCACTGCACAGGGAAAGG - Intergenic
928680832 2:33700574-33700596 TGGTGTCATTGCAAAGGCAGTGG - Intergenic
931122293 2:59233427-59233449 TTTTGACTCTACAAAGGCAATGG - Intergenic
931166319 2:59752898-59752920 TTGTTCCACTGGAAGGTCAATGG + Intergenic
934299193 2:91767014-91767036 CTTTGTCACTGCAAAGGAAAGGG - Intergenic
935222885 2:101029769-101029791 TTGTGCCCCTGGAAAAGAAAGGG + Exonic
935812693 2:106815250-106815272 TAGTGCCAGTGCAAAGGGTATGG - Intronic
936392988 2:112092565-112092587 TTCGACCACTGCAAAGGCAAAGG - Intronic
936619956 2:114085197-114085219 TTGTGCTACTGCAGAGGCCTTGG - Intergenic
936985712 2:118310077-118310099 TTGTGGCACTCCGAAGGCAGCGG + Intergenic
937099328 2:119256638-119256660 TTTTGCCACTGCAAGAGCAGGGG + Intronic
937687521 2:124714498-124714520 TAGTGTTACTTCAAAGGCAAAGG + Intronic
937748376 2:125443397-125443419 TGGTGACACTGAAAAGGGAATGG - Intergenic
938558072 2:132444334-132444356 TTGTACCACTGCACAGCCTAAGG - Intronic
940821260 2:158358448-158358470 TTCTGCCTCTGCAAAGCTAAAGG - Exonic
941725013 2:168851264-168851286 GTGTGGCACTGCAATGCCAAGGG - Exonic
945016293 2:205520412-205520434 TGGTTCCACTGCAGAGGCAGTGG + Intronic
948191976 2:236066268-236066290 TTGTGCCACTGCACCAGCTAGGG - Intronic
1169270099 20:4192583-4192605 TTGTTCCACAGCAGAGGAAATGG + Intergenic
1171196625 20:23205010-23205032 TTCTGACACTGCAAAGAGAAAGG + Intergenic
1175025632 20:55899384-55899406 TCGTGCCACTGCACTGGCGACGG + Intergenic
1178040332 21:28633766-28633788 CTGAGCCATTGCAAAGACAAAGG + Intergenic
1178447771 21:32661244-32661266 TTGTGCTACTGCTTTGGCAAGGG - Intronic
1179136852 21:38687286-38687308 TTCAGCCTCTGCACAGGCAATGG + Intergenic
1184115897 22:42422056-42422078 TGGCGCCATTCCAAAGGCAACGG - Intronic
1184482933 22:44758696-44758718 GTGTGCCAGGGCAAAGGCAGTGG + Intronic
951165952 3:19485432-19485454 TTGTGCTACTGCTTTGGCAAGGG + Intronic
952564463 3:34638277-34638299 TTGTGTCACTGCCATGGAAAGGG + Intergenic
952573622 3:34747538-34747560 ATGTGGCTCTGCAAAAGCAAAGG + Intergenic
952844558 3:37676404-37676426 TTGTCCCACTCAATAGGCAAGGG + Intronic
953095706 3:39773793-39773815 TTGTGTTATTGCAAAGGCAATGG - Intergenic
955090586 3:55746637-55746659 TTGTGCTTCTGCAAAGGAGAAGG + Intronic
955865357 3:63376550-63376572 TTCAGCAACTGCAAAGGCACTGG - Intronic
956839565 3:73125122-73125144 TTTTGCCTCTGCAACGGCAGAGG + Intergenic
958489504 3:94753839-94753861 GTGTGACACAGCAAAGTCAATGG - Intergenic
962347582 3:134629688-134629710 TTGTGTCCCTACAAAGGAAAAGG + Exonic
964522339 3:157582742-157582764 TTGTGCTACTGCTTTGGCAAGGG + Intronic
969580811 4:8063825-8063847 TTGGGGCACAGCAAAGGCAAGGG - Intronic
969857122 4:10009051-10009073 TTGTGTCACTGCAGAAACAACGG - Intronic
973803266 4:54499148-54499170 ATGTGCCACGGAAAAGCCAAAGG - Intergenic
974843453 4:67323709-67323731 TTGTACCCCTGCAAAGCCACAGG + Intergenic
974906781 4:68067830-68067852 TAGTGCCACTGGCCAGGCAAAGG + Intronic
977971555 4:103218847-103218869 TAGTACCACTGCAGAGGCCATGG - Intergenic
979758744 4:124374000-124374022 GTGTACCATTGCAGAGGCAAAGG + Intergenic
980780212 4:137483513-137483535 TTGTGCTACTGCTTTGGCAAGGG - Intergenic
981176228 4:141687159-141687181 TGGAGCCACTGCCAAGGCACTGG - Intronic
983544986 4:168953460-168953482 TTGTGCCACTGCAAAGGCAACGG - Intronic
984926104 4:184808456-184808478 ATTTGCCACTGCAGGGGCAAGGG - Intronic
985895268 5:2746646-2746668 TTGTGCCACTGTAAAAGAGAAGG - Exonic
986110960 5:4716978-4717000 TTGTTCTGCTGCAAATGCAAAGG - Intergenic
986966917 5:13284607-13284629 TGGTTCTACTACAAAGGCAATGG + Intergenic
991126319 5:63073578-63073600 TTGTGTCACTGCTAAGGTAATGG - Intergenic
993634342 5:90326082-90326104 TAGTACCACTGCAGTGGCAATGG + Intergenic
995187831 5:109290266-109290288 TGGTTCCACTGCAGAGGCAGTGG - Intergenic
995990841 5:118237725-118237747 ATGTCCCACTGAAAAGGCATAGG + Intergenic
997398226 5:133581545-133581567 TTGTGCCTGGGCAAAGGCACAGG + Intronic
998948632 5:147368137-147368159 CATTGCCATTGCAAAGGCAAAGG + Intronic
999915094 5:156249665-156249687 TTATGCAACTGCAAAGGAATTGG + Intronic
1003700601 6:8460749-8460771 ATGTCCCACTTCAAAGGCACAGG - Intergenic
1003804432 6:9710620-9710642 TTTTGCCTCTTCAAAGGGAAGGG + Intronic
1006195593 6:32239899-32239921 GTGAGCCACTGCAGAGGGAAAGG + Intergenic
1007150868 6:39689639-39689661 TTGTGCCACTGCACGGGCCTGGG - Intronic
1008371900 6:50741939-50741961 TTGTGCCACCACAGAGGCAGAGG + Intronic
1008817131 6:55580900-55580922 TTGTTCCACTGCAAGTGAAATGG + Intergenic
1008973696 6:57400065-57400087 ATGTCCCACTTCAAAGGCACAGG - Intronic
1009162586 6:60301608-60301630 ATGTCCCACTTCAAAGGCACAGG - Intergenic
1009588195 6:65633855-65633877 TTTTCCCGCTGCAATGGCAAAGG + Intronic
1010019244 6:71139934-71139956 TAGTACCACTGCAGAGGCAGTGG - Intergenic
1013212971 6:108003201-108003223 TTGTGCTAGTGAAAAGGAAACGG + Intergenic
1014100305 6:117504508-117504530 TTGTGCCACTTCAAATGGGATGG + Intronic
1014192287 6:118510869-118510891 TCGTGTAACTGCAAAAGCAAGGG + Intronic
1014546833 6:122745021-122745043 TTGTGCTACTGCTTTGGCAAGGG + Intergenic
1018638322 6:165884213-165884235 CTGGGAGACTGCAAAGGCAAGGG + Intronic
1020447105 7:8280560-8280582 TTCTGCCACTGCAAATAAAAAGG + Intergenic
1021328120 7:19299906-19299928 TTCTGCCATTGCTGAGGCAAAGG + Intergenic
1021362990 7:19739987-19740009 TTGTGGGACTGCTGAGGCAAAGG - Intronic
1023020469 7:36007598-36007620 TTGTCCCACTTAAGAGGCAATGG + Intergenic
1023622245 7:42085811-42085833 TTGTGCAACTGTGAAGACAAGGG - Intronic
1028075077 7:86502574-86502596 TTGGGCCATTGCCATGGCAAGGG + Intergenic
1028298776 7:89170337-89170359 TTCTGCATCTACAAAGGCAATGG - Intronic
1028518927 7:91707598-91707620 TTGTGCCACTGCTAGGGGCAGGG - Intronic
1028723212 7:94057897-94057919 TTGTTCCAGTCCAAATGCAATGG + Intergenic
1029884616 7:103855356-103855378 GTGTGCCACTGCAGACACAATGG + Intronic
1030296385 7:107932675-107932697 TTCTGCCAGTGCAAGGGCCAAGG + Intronic
1030511264 7:110485061-110485083 TTGTGCCCCTACAAAGTGAAGGG + Intergenic
1030609891 7:111678029-111678051 TTGTGCCACAGCCTGGGCAAGGG - Intergenic
1031116496 7:117674558-117674580 TGCTGCCAATGAAAAGGCAAAGG - Intronic
1032174654 7:129612679-129612701 TTTTGCCACTGGAAAGACAGGGG + Intronic
1032951744 7:136922271-136922293 TAGTGCCAGAGCAAATGCAAAGG - Intronic
1035009056 7:155696018-155696040 CTGTGGCACTCCAAAGGGAAAGG - Intronic
1035678104 8:1468988-1469010 TGGGGCCACTGCAAAGACCAAGG + Intergenic
1036606536 8:10310501-10310523 TTGTAACACTAGAAAGGCAAAGG - Intronic
1038035272 8:23682049-23682071 TTGTGCCACTGGAGACGCAGAGG + Intronic
1041467561 8:58172478-58172500 TTGTCAAACTGCAAAGTCAAAGG - Intronic
1041713245 8:60911715-60911737 TGCTGCCAGTGCAGAGGCAAGGG + Intergenic
1042619922 8:70693873-70693895 ATGTTCCACTGCAGAGGCAGTGG + Intronic
1046035819 8:108840178-108840200 TTGTTCCAGTGCAAATCCAAAGG + Intergenic
1048983148 8:139714123-139714145 TCATGGCAATGCAAAGGCAATGG + Intergenic
1049267906 8:141679205-141679227 TGGTAGCACTGCAAAGGTAATGG + Intergenic
1051617155 9:19017136-19017158 TTGTTGCAAGGCAAAGGCAAAGG + Intronic
1051678076 9:19578872-19578894 CTTTGCCACAACAAAGGCAAAGG + Intronic
1051822251 9:21181599-21181621 TAGTACCACTGCAGAGGCAGTGG - Intergenic
1051827283 9:21234255-21234277 TAGTACCACTGCAGAGGCAGTGG - Intronic
1051923738 9:22298734-22298756 TTCTGCCTTTGGAAAGGCAAGGG - Intergenic
1053826051 9:42025642-42025664 TTGTGTCACTGCAGTTGCAAAGG + Intronic
1054604512 9:67161754-67161776 TTGTGTCACTGCAGTTGCAAAGG - Intergenic
1055664980 9:78544417-78544439 TTTTCCAACTGCAAAGGCAGAGG - Intergenic
1058062016 9:100507487-100507509 TTGTGGGACTGCAAAGAAAAGGG - Intronic
1059022721 9:110593957-110593979 TTGCAGCACTGCAATGGCAAAGG - Intergenic
1060538955 9:124416322-124416344 TGGTGCCACTGCCATGGAAAGGG - Intergenic
1060572499 9:124655524-124655546 TTGTGCCTCTGTATAGGCACAGG - Intronic
1061064511 9:128269004-128269026 TTGTGCCACTGCAGGGGAGAAGG - Intronic
1061945937 9:133908185-133908207 TGGTGCCACTTCAAAGGGGAGGG - Intronic
1185910025 X:3972647-3972669 TTGTGCTACTGCTTTGGCAAGGG - Intergenic
1186560528 X:10607643-10607665 TTATGCAAATGCAAAGGCAATGG + Intronic
1186890527 X:13955237-13955259 TTGTGCCACAGCAAAGGGCCAGG + Intergenic
1187219366 X:17308669-17308691 CTGTGCCACTGTAGAGGCAGTGG - Intergenic
1188066622 X:25669514-25669536 GTGTGCTACAGCAAAGACAAAGG + Intergenic
1188812092 X:34662909-34662931 TTGTTCCACTGGACAAGCAATGG - Intergenic
1189300422 X:39948457-39948479 GTGTGCCACTGTAAGGGGAAGGG - Intergenic
1190390404 X:49925431-49925453 TTTTGTCCCTGCAAAGACAAAGG - Intronic
1191122988 X:56925601-56925623 TAGTACCACTGCAGAGGCAGTGG + Intergenic
1192054072 X:67755719-67755741 TTGTGCCTCTGGGAAGGCGAAGG + Intergenic
1192388239 X:70696117-70696139 TTTTGCAACTGCAAAGCAAATGG - Intronic
1193468823 X:81875816-81875838 TTCTGAGACTGCAAAGGCAGTGG + Intergenic
1193569840 X:83128397-83128419 CTCTGCCACTGCCAAGGCAGTGG + Intergenic
1193607259 X:83583781-83583803 TAATGCCACTGCAGAGGCAGGGG - Intergenic
1194068383 X:89289240-89289262 TTGTGACTCTGCCAAGGGAAGGG + Intergenic
1194839213 X:98717976-98717998 TTGTGCCACTGGAACTCCAATGG + Intergenic
1194849810 X:98856766-98856788 TTGTGCAGCAGCAAAGGCATGGG + Intergenic
1196467865 X:115991490-115991512 CTCTGCCACTGGAAAGGGAAGGG + Intergenic
1197399736 X:125975044-125975066 TTCTGCCACTGAAAAGGGGAGGG + Intergenic
1197834710 X:130682279-130682301 ATGTAACACTGAAAAGGCAAAGG + Intronic
1198706056 X:139449285-139449307 ATGTGCCAGACCAAAGGCAATGG - Intergenic
1198777763 X:140198914-140198936 TTGTTCAACTGCAAAGAGAAAGG - Intergenic
1200394017 X:155972455-155972477 TTGTGCTACTGCTTTGGCAAGGG + Intergenic
1200722526 Y:6623409-6623431 TTGTGACTCTGCCAAGGGAAGGG + Intergenic
1200758360 Y:7013185-7013207 TTGGGGCACAGGAAAGGCAAGGG - Intronic
1201794253 Y:17877769-17877791 TTGTGCCACTATAAAGTCAAGGG + Exonic
1201807301 Y:18028216-18028238 TTGTGCCACTATAAAGTCAAGGG - Exonic
1202036532 Y:20642134-20642156 TCGTGCCACTGCCTAGGCAACGG - Intergenic
1202340064 Y:23854742-23854764 TTGTGCCACTATAAAGTCAAAGG + Intergenic
1202355634 Y:24045588-24045610 TTGTGCCACTATAAAGTCAAGGG + Exonic
1202515144 Y:25624521-25624543 TTGTGCCACTATAAAGTCAAGGG - Exonic
1202530702 Y:25815340-25815362 TTGTGCCACTATAAAGTCAAAGG - Intergenic