ID: 983547704

View in Genome Browser
Species Human (GRCh38)
Location 4:168980026-168980048
Sequence ATGATTATTCTGATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983547696_983547704 5 Left 983547696 4:168979998-168980020 CCCCAGCTTGGGCCCACAACACA 0: 1
1: 11
2: 33
3: 111
4: 259
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547693_983547704 8 Left 983547693 4:168979995-168980017 CCCCCCCAGCTTGGGCCCACAAC 0: 1
1: 1
2: 3
3: 17
4: 240
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547694_983547704 7 Left 983547694 4:168979996-168980018 CCCCCCAGCTTGGGCCCACAACA 0: 1
1: 2
2: 8
3: 25
4: 408
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547689_983547704 29 Left 983547689 4:168979974-168979996 CCTGCTCTTCACCAGGCAGGGCC 0: 4
1: 28
2: 64
3: 95
4: 383
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547698_983547704 3 Left 983547698 4:168980000-168980022 CCAGCTTGGGCCCACAACACACT 0: 1
1: 1
2: 3
3: 27
4: 159
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547688_983547704 30 Left 983547688 4:168979973-168979995 CCCTGCTCTTCACCAGGCAGGGC 0: 4
1: 25
2: 54
3: 93
4: 374
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547701_983547704 -7 Left 983547701 4:168980010-168980032 CCCACAACACACTGGGATGATTA 0: 1
1: 0
2: 1
3: 37
4: 319
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547695_983547704 6 Left 983547695 4:168979997-168980019 CCCCCAGCTTGGGCCCACAACAC 0: 1
1: 7
2: 32
3: 84
4: 429
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547690_983547704 18 Left 983547690 4:168979985-168980007 CCAGGCAGGGCCCCCCCAGCTTG 0: 1
1: 1
2: 2
3: 32
4: 305
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547702_983547704 -8 Left 983547702 4:168980011-168980033 CCACAACACACTGGGATGATTAT 0: 1
1: 0
2: 1
3: 15
4: 243
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data
983547697_983547704 4 Left 983547697 4:168979999-168980021 CCCAGCTTGGGCCCACAACACAC 0: 1
1: 2
2: 22
3: 102
4: 245
Right 983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983547704 Original CRISPR ATGATTATTCTGATGGACAA TGG Intronic
No off target data available for this crispr