ID: 983552626

View in Genome Browser
Species Human (GRCh38)
Location 4:169032989-169033011
Sequence CTGTTTCCACAGGTGTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983552626_983552629 -10 Left 983552626 4:169032989-169033011 CCAATTTACACCTGTGGAAACAG No data
Right 983552629 4:169033002-169033024 GTGGAAACAGAGGCACAGATAGG No data
983552626_983552630 20 Left 983552626 4:169032989-169033011 CCAATTTACACCTGTGGAAACAG No data
Right 983552630 4:169033032-169033054 CACCCCCAGTGATGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983552626 Original CRISPR CTGTTTCCACAGGTGTAAAT TGG (reversed) Intergenic
No off target data available for this crispr