ID: 983555575

View in Genome Browser
Species Human (GRCh38)
Location 4:169056335-169056357
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983555573_983555575 -9 Left 983555573 4:169056321-169056343 CCATCTGGGAATCACTGAATTAT No data
Right 983555575 4:169056335-169056357 CTGAATTATGTTGAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr