ID: 983555807

View in Genome Browser
Species Human (GRCh38)
Location 4:169058403-169058425
Sequence ACCGGGCCGTTAGAGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983555790_983555807 30 Left 983555790 4:169058350-169058372 CCCCACTTTCCAAAGTTCCTGTC No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555792_983555807 28 Left 983555792 4:169058352-169058374 CCACTTTCCAAAGTTCCTGTCCC No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555795_983555807 13 Left 983555795 4:169058367-169058389 CCTGTCCCTCTCCAGGAACAAAA No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555793_983555807 21 Left 983555793 4:169058359-169058381 CCAAAGTTCCTGTCCCTCTCCAG No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555800_983555807 2 Left 983555800 4:169058378-169058400 CCAGGAACAAAAGGCCATGGTGG No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555791_983555807 29 Left 983555791 4:169058351-169058373 CCCACTTTCCAAAGTTCCTGTCC No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555798_983555807 7 Left 983555798 4:169058373-169058395 CCTCTCCAGGAACAAAAGGCCAT No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data
983555797_983555807 8 Left 983555797 4:169058372-169058394 CCCTCTCCAGGAACAAAAGGCCA No data
Right 983555807 4:169058403-169058425 ACCGGGCCGTTAGAGGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983555807 Original CRISPR ACCGGGCCGTTAGAGGTCAT GGG Intergenic
No off target data available for this crispr