ID: 983556011

View in Genome Browser
Species Human (GRCh38)
Location 4:169059793-169059815
Sequence CGGGCTTCCTACCCAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983556006_983556011 1 Left 983556006 4:169059769-169059791 CCATAGTTCCATGAAAGGCTCCT No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556003_983556011 6 Left 983556003 4:169059764-169059786 CCTTCCCATAGTTCCATGAAAGG No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983555999_983556011 26 Left 983555999 4:169059744-169059766 CCCCTCTGCGTCAGAGGAGCCCT No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556001_983556011 24 Left 983556001 4:169059746-169059768 CCTCTGCGTCAGAGGAGCCCTTC No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556002_983556011 7 Left 983556002 4:169059763-169059785 CCCTTCCCATAGTTCCATGAAAG No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556009_983556011 -7 Left 983556009 4:169059777-169059799 CCATGAAAGGCTCCTTCGGGCTT No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556005_983556011 2 Left 983556005 4:169059768-169059790 CCCATAGTTCCATGAAAGGCTCC No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data
983556000_983556011 25 Left 983556000 4:169059745-169059767 CCCTCTGCGTCAGAGGAGCCCTT No data
Right 983556011 4:169059793-169059815 CGGGCTTCCTACCCAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983556011 Original CRISPR CGGGCTTCCTACCCAGCTGA TGG Intergenic
No off target data available for this crispr