ID: 983557527

View in Genome Browser
Species Human (GRCh38)
Location 4:169071688-169071710
Sequence CAGAGCTTTCACATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983557527_983557531 17 Left 983557527 4:169071688-169071710 CCATCTTCCATGTGAAAGCTCTG No data
Right 983557531 4:169071728-169071750 CTATGTCATCACTCCCCCCATGG No data
983557527_983557533 30 Left 983557527 4:169071688-169071710 CCATCTTCCATGTGAAAGCTCTG No data
Right 983557533 4:169071741-169071763 CCCCCCATGGCCCTTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983557527 Original CRISPR CAGAGCTTTCACATGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr