ID: 983558186

View in Genome Browser
Species Human (GRCh38)
Location 4:169076922-169076944
Sequence ATCCTTGACCTACTCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983558186_983558194 30 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558194 4:169076975-169076997 ACAAGACACTTTGGGCTTTCAGG No data
983558186_983558191 0 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558191 4:169076945-169076967 CCACATTGTCTGGAGAAAAGGGG No data
983558186_983558188 -2 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558188 4:169076943-169076965 ATCCACATTGTCTGGAGAAAAGG No data
983558186_983558193 22 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558193 4:169076967-169076989 GCAAACTCACAAGACACTTTGGG No data
983558186_983558189 -1 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558189 4:169076944-169076966 TCCACATTGTCTGGAGAAAAGGG No data
983558186_983558192 21 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558192 4:169076966-169076988 GGCAAACTCACAAGACACTTTGG No data
983558186_983558187 -10 Left 983558186 4:169076922-169076944 CCTTGCAGGAGTAGGTCAAGGAT No data
Right 983558187 4:169076935-169076957 GGTCAAGGATCCACATTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983558186 Original CRISPR ATCCTTGACCTACTCCTGCA AGG (reversed) Intergenic
No off target data available for this crispr