ID: 983561775

View in Genome Browser
Species Human (GRCh38)
Location 4:169108838-169108860
Sequence TCTAAGCTTTAGTAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561775_983561783 21 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561783 4:169108882-169108904 GGATGAAACCAGTGGAAGGAAGG No data
983561775_983561780 0 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561775_983561781 13 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG 0: 1
1: 0
2: 4
3: 24
4: 307
983561775_983561782 17 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 316
983561775_983561779 -6 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561775 Original CRISPR TCTAAGCTTTAGTAGGTGTA GGG (reversed) Intronic
900622737 1:3594873-3594895 CCTCAGCTTCAGTGGGTGTAAGG - Intronic
906630617 1:47364189-47364211 TCTAAGGTTTAGTAGTCTTATGG + Intronic
911430500 1:97779855-97779877 TCTAACTTTTACTAGCTGTAGGG + Intronic
917007947 1:170436413-170436435 CCTAACCTTTAGTAGGCTTATGG - Intergenic
920336222 1:205247140-205247162 CCTCAGCTTTGTTAGGTGTATGG + Intronic
922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG + Intronic
923277712 1:232413059-232413081 TCTAAGCTGAAGTAAGAGTATGG - Intronic
923380237 1:233410466-233410488 TGTAAGCTGTAGTAGATGTTTGG + Intergenic
1068210994 10:53920262-53920284 TCTAATGTTTTATAGGTGTATGG - Intronic
1074439574 10:113464415-113464437 TTTAAGCTTTTGTTGGAGTAGGG - Intergenic
1080069512 11:28063570-28063592 GATAAGGTTTAGTAGGTTTAAGG - Intronic
1081056151 11:38413088-38413110 TCTAAGCTTTACCAAGTTTAAGG - Intergenic
1083766858 11:64845378-64845400 TTTAAGCTTCAGTAGGAGCAGGG + Intergenic
1085507669 11:77069432-77069454 TCTTGGCTTTAGTGGGTGAAGGG + Intronic
1087468022 11:98534930-98534952 TCTAAACATTAGTAGGAGTATGG - Intergenic
1087813084 11:102629942-102629964 TATAAGAATTGGTAGGTGTAAGG - Intergenic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1091328078 11:134707114-134707136 TCTGGGCTGCAGTAGGTGTAGGG + Intergenic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1101795231 12:107966922-107966944 TCTAAGTTTTAGTAGAAATAAGG + Intergenic
1104215548 12:126729334-126729356 TCTAAGATTTAGTATGTAAAAGG + Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1106034041 13:26027777-26027799 TTGTAGCTTTAGTAGGTGGAAGG - Intergenic
1110328314 13:74242691-74242713 TCAATTGTTTAGTAGGTGTAGGG + Intergenic
1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG + Intergenic
1119790112 14:77342358-77342380 TCTATCATTTAGTAGGTGAAAGG + Intronic
1122471818 14:101973330-101973352 TTTAATTTTTAGTAGGTATAGGG + Intronic
1123912457 15:24981658-24981680 ACTAAGCATTATTATGTGTATGG - Intergenic
1126945313 15:53812829-53812851 TGTGAGCTTTAATTGGTGTATGG + Intergenic
1127505797 15:59596587-59596609 GCAAACCTTTAGTAGGTGGAAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1139111442 16:63896308-63896330 TATAAGCTTTACAAGGGGTAAGG - Intergenic
1139619569 16:68126643-68126665 TCTAATCATCACTAGGTGTATGG - Intronic
1146989993 17:37261128-37261150 TTTAAGGTTTAGTTGGTGTGTGG - Intronic
1151118895 17:71770296-71770318 TCTGAGTTTTAGTAGGAGAAAGG + Intergenic
1165209821 19:34225312-34225334 TTTATGATTTAGGAGGTGTAGGG - Intronic
929035234 2:37684525-37684547 AGTAAACTTTAGTAGGTGAATGG + Intronic
929337846 2:40772554-40772576 TCTTAGCCTGAGTAGGTGTCAGG - Intergenic
929477769 2:42270117-42270139 TCTAAGCCTAAATATGTGTAAGG - Intronic
930707456 2:54518948-54518970 TCTAAATTTTATTATGTGTATGG + Intronic
936752442 2:115661450-115661472 TCTAAGTTTTGTTAGGTGAATGG + Intronic
938569055 2:132545528-132545550 TCTTAGCATTAGTAAGTGTTTGG - Intronic
946910730 2:224457910-224457932 TCTAAGCTTAACTTGGTTTACGG - Intergenic
1169024406 20:2356864-2356886 TCTATGATTTAGTGGGTGTTGGG + Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1170864297 20:20139331-20139353 TCTAAGCTTTATTAGCTTCATGG + Intronic
1174971811 20:55284634-55284656 TCTAAGCTTTAAATGGTATATGG + Intergenic
1177552500 21:22643869-22643891 TCTCAGATTTAGTATGTGGATGG - Intergenic
1178708533 21:34894134-34894156 GCTCAGCTTTAATAGGTGTTGGG + Intronic
950934755 3:16827367-16827389 TCAAAGCTTTGGAAGATGTAAGG - Intronic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
951317796 3:21207543-21207565 TCTAATCTTTAGTACATGGAAGG - Intergenic
957304543 3:78440892-78440914 CCAAAGCTGTGGTAGGTGTATGG + Intergenic
960092330 3:113653647-113653669 TCTATGCTTTAGCAGGTCTCAGG + Exonic
963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG + Intronic
967046343 3:185740717-185740739 TCTAACCTTTACTAGGTATATGG - Intronic
968833742 4:2947786-2947808 GCTAAGCACTAGAAGGTGTAGGG + Intronic
975836358 4:78426279-78426301 TGAAAGCTTGAGTAGGTGAAGGG + Intronic
979761485 4:124410677-124410699 TCTAATCTTTAGTAAGCATATGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984590818 4:181615652-181615674 TCTAAGCATTAGTAGGAGCACGG - Intergenic
985136697 4:186793322-186793344 GCTAAGCTTAAGTAGGTGCCTGG + Intergenic
988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG + Intronic
990863428 5:60353506-60353528 TATGAGATTTAGTAGGTGGAAGG - Intronic
993916776 5:93753751-93753773 TCTAAGCTATAGTAGGGGCAAGG + Intronic
1001212080 5:169819446-169819468 TTTAATTTTTTGTAGGTGTAGGG - Intronic
1002193137 5:177489260-177489282 TCTCAGCTGGAGTAGGAGTAGGG - Intronic
1002589733 5:180282062-180282084 TCTAAGCTATAGGAGGTGCGAGG + Intronic
1005581032 6:27235386-27235408 TCTAAGAATTAGAAAGTGTAGGG + Intergenic
1007132483 6:39488743-39488765 TCTAATGTTTAGTTGGTGAATGG - Intronic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1010879845 6:81153847-81153869 CCTAGATTTTAGTAGGTGTATGG - Intergenic
1010906986 6:81502808-81502830 TCTAATATTTAGTATCTGTAAGG + Intronic
1012762085 6:103315432-103315454 TTTAATTTTTATTAGGTGTAAGG + Intergenic
1014991348 6:128081740-128081762 TATAAACTTTAGTAGATTTAGGG + Intronic
1022816095 7:33915867-33915889 TCTACCCTTTAATAGTTGTATGG + Intronic
1024372533 7:48603107-48603129 TCTCAGCTTTAGGAGATTTAGGG + Intronic
1045204698 8:100026015-100026037 CCTAAGGTATAGTAGGTGTTTGG + Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1048436347 8:134422108-134422130 TCTGAGCATTACTAGGTCTAGGG - Intergenic
1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG + Intergenic
1052948817 9:34191180-34191202 TCAAAGTTTTAGTGTGTGTATGG + Intronic
1055729965 9:79270463-79270485 TCTATGCTTTTGTGGCTGTAAGG - Intergenic
1057420990 9:94912254-94912276 TCTTAGCTTTGTTAGGTGTTTGG + Intronic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1189329755 X:40136655-40136677 CCAAAGCTTTGGTAGGCGTATGG + Intronic
1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG + Intergenic
1194002476 X:88449097-88449119 TCTAAACTTTTGTAGCTGTGTGG - Intergenic
1194545019 X:95223097-95223119 TCTAAGCTTCAGTAAATATAAGG + Intergenic
1195195728 X:102496611-102496633 TCTAAACTGTAGTGAGTGTAGGG + Intergenic
1199540692 X:148955010-148955032 ACTGAGCTTTCGTCGGTGTATGG - Intronic