ID: 983561779

View in Genome Browser
Species Human (GRCh38)
Location 4:169108855-169108877
Sequence CTTAGAGGCTGAGAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561776_983561779 -7 Left 983561776 4:169108839-169108861 CCTACACCTACTAAAGCTTAGAG 0: 1
1: 1
2: 1
3: 4
4: 99
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231
983561769_983561779 26 Left 983561769 4:169108806-169108828 CCTCTCTATCTCACCCAGTGCCT 0: 1
1: 0
2: 1
3: 19
4: 304
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231
983561774_983561779 6 Left 983561774 4:169108826-169108848 CCTAGTGCAGGGCCCTACACCTA 0: 1
1: 0
2: 0
3: 16
4: 361
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231
983561773_983561779 12 Left 983561773 4:169108820-169108842 CCAGTGCCTAGTGCAGGGCCCTA 0: 1
1: 0
2: 2
3: 22
4: 160
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231
983561775_983561779 -6 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231
983561772_983561779 13 Left 983561772 4:169108819-169108841 CCCAGTGCCTAGTGCAGGGCCCT 0: 1
1: 1
2: 7
3: 40
4: 286
Right 983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG 0: 1
1: 0
2: 0
3: 17
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561779 Original CRISPR CTTAGAGGCTGAGAAAATAC TGG Intronic
902123364 1:14187029-14187051 CTGAGAAGATGAGAAAATGCTGG - Intergenic
908872288 1:68627106-68627128 ATGAGAGGGTGAGAAAATATTGG - Intergenic
913266667 1:117051888-117051910 CTTAGTAGCTGAGAAAACTCTGG - Intergenic
913652398 1:120930687-120930709 ATCAGGGGCTGAGAAAATGCTGG + Intergenic
914168710 1:145198382-145198404 ATCAGGGGCTGAGAAAATGCTGG - Intergenic
914523832 1:148442341-148442363 ATCAGGGGCTGAGAAAATGCTGG - Intergenic
914599843 1:149193526-149193548 ATCAGGGGCTGAGAAAATGCTGG + Intergenic
914642574 1:149624799-149624821 ATCAGGGGCTGAGAAAATGCTGG + Intergenic
915542109 1:156574012-156574034 CTCAGGGGCTGAGACAAAACTGG + Intergenic
916404942 1:164489056-164489078 CTCAGAGGCTGAAAAACAACAGG - Intergenic
916437715 1:164792319-164792341 CTGAGAGGGTGAGAAAATGAAGG - Intronic
917180352 1:172290068-172290090 TTTGAATGCTGAGAAAATACTGG + Intronic
919985795 1:202673749-202673771 ATTAAAGGCTGAGAAACTAGAGG - Intronic
923305661 1:232686037-232686059 CATAGAGTCTGGGAAAAGACAGG - Intergenic
1065062105 10:21913036-21913058 AGTAGTGGCTGAGAAAATAGAGG - Intronic
1072817955 10:98528089-98528111 CTTCAAGGCATAGAAAATACAGG - Intronic
1074203915 10:111264885-111264907 CCTAGAGACTGAGAAGATTCTGG + Intergenic
1075201796 10:120410791-120410813 CTTAGAGTCTGTGAAACTGCGGG + Intergenic
1076810361 10:132883386-132883408 ATCAGTGGCTGGGAAAATACAGG + Intronic
1080084455 11:28261202-28261224 CTTTGAGCCAGAGAAAACACAGG - Intronic
1081345968 11:41986557-41986579 TTTTGATGCTGAGAAAATAATGG + Intergenic
1081467932 11:43341571-43341593 ACTAGAGGCTGAGAAGATAGGGG + Intronic
1084664944 11:70571308-70571330 CTTAGAGGCTGAGTGACTTCCGG + Intronic
1085939339 11:81189827-81189849 CTGAGATGCTGAAAAAATAAAGG - Intergenic
1087628417 11:100622750-100622772 CCTAGAAGCTGAGAAGATGCCGG - Intergenic
1092130885 12:6112442-6112464 CTTGGAGACTGAGAAATTAATGG + Intronic
1095908431 12:47401705-47401727 CAGCGAGGCTGAGAAAATAAGGG + Intergenic
1097919688 12:65058348-65058370 CATAGAGGAGGAGAAAATTCGGG - Intronic
1098255607 12:68611777-68611799 CTTAGAGGGAGAGAAAATCCAGG + Intronic
1098553271 12:71788669-71788691 CTTACTGGCTGAAAAAATACTGG - Exonic
1098745736 12:74234920-74234942 CTTAGAGGAAGAGAAGATTCAGG + Intergenic
1102437568 12:112937347-112937369 CTCAGAGGCAGAGTAAATGCTGG + Intergenic
1102618611 12:114176016-114176038 CTAAGAGGTTGTGAAAGTACTGG + Intergenic
1104087530 12:125490331-125490353 CTTTGAGGCTGGGCAGATACGGG - Intronic
1104533266 12:129593209-129593231 CTTAGAAGCTGCAAGAATACTGG + Intronic
1105421110 13:20253273-20253295 CCTAGAAGCTGAGCAAATGCTGG - Intergenic
1106359901 13:29021286-29021308 TATAATGGCTGAGAAAATACTGG + Intronic
1107420727 13:40244015-40244037 CTTAGAAGCTGGGAAAAAATTGG - Intergenic
1107723915 13:43277884-43277906 CAGAGAGGTTGAGAAAACACAGG + Intronic
1109819048 13:67627652-67627674 CTTAGAGGCTGGAGAAATAAAGG - Intergenic
1110773091 13:79373987-79374009 CTTAGAGGTTGAACAAATTCAGG + Intronic
1111385764 13:87525385-87525407 TTAAGAGGCTGAGAAAACAATGG + Intergenic
1113181092 13:107627522-107627544 CTTTCATGCAGAGAAAATACAGG - Intronic
1113794116 13:113046986-113047008 CTCAGAAGCTGAGAAGATGCAGG - Intronic
1115718532 14:36133435-36133457 CATAGAGGTAGAGAAAATTCTGG + Intergenic
1118476452 14:66121751-66121773 CTTAGAGGTTGAATAATTACTGG - Intergenic
1119591083 14:75888564-75888586 CTTTAAGGATGAGCAAATACTGG + Intronic
1119765190 14:77183366-77183388 CTTAAAGGAGGAGAAAATGCTGG - Intronic
1120564238 14:86035217-86035239 CTTAGAGGCCGAGGATATCCAGG + Intergenic
1120653294 14:87160234-87160256 CTTAAAGGCTGAGAAAAATGAGG + Intergenic
1120718805 14:87868551-87868573 CTTAGGGGCACAGAAAAGACTGG - Intronic
1121056483 14:90859224-90859246 CTTGCAGTCTGATAAAATACAGG - Exonic
1122053870 14:99079128-99079150 CTGAGTGGCTGAGAACATACTGG + Intergenic
1122140839 14:99662099-99662121 CAGAGCGGCTGGGAAAATACTGG - Intronic
1124183517 15:27500582-27500604 CTTAGGGGCTGGGAATATAAGGG - Intronic
1127031102 15:54863899-54863921 CTAAGAGGCAGAGAAAACAATGG - Intergenic
1128572345 15:68743287-68743309 AAAAGATGCTGAGAAAATACAGG + Intergenic
1128771525 15:70286259-70286281 CTGGGAGGCTTAGAAAACACTGG + Intergenic
1129185296 15:73902466-73902488 CTGAGAGGCAGAGAAAAGAGGGG - Intergenic
1129696073 15:77741342-77741364 CTGAGAGGCTGGGAAACTCCTGG + Intronic
1130925321 15:88381317-88381339 CTGAGAGGGTGAGATAATGCAGG + Intergenic
1131295260 15:91142454-91142476 ATGAGATGCTGAGGAAATACAGG + Intronic
1131734710 15:95319822-95319844 CTTAGAGGCTGAGAGTAGAATGG - Intergenic
1132379752 15:101358280-101358302 CTTAGTAGCATAGAAAATACAGG - Intronic
1133155824 16:3875078-3875100 CTTAGAAGCTGTGAAAACACAGG + Intronic
1135977787 16:27122192-27122214 CTCAGAGGCAGAGAACAAACAGG + Intergenic
1138556632 16:57774825-57774847 CTTTGAGACTGAAAAATTACTGG - Intronic
1139645724 16:68328423-68328445 CTGAGAGGCTGAGGAAAGACTGG - Intronic
1141321064 16:83009228-83009250 CTCAGAAGATGACAAAATACTGG - Intronic
1142438232 16:90076760-90076782 ATTTGAGGCTGAGGAAATTCTGG + Intronic
1143306025 17:5947307-5947329 CCTTGTGGCTGAGAAAATAAGGG - Intronic
1147239730 17:39082874-39082896 TTTAGAAGCTCAGAAAATTCTGG - Intronic
1151245995 17:72795156-72795178 CTCAGAGACTGAGACCATACAGG - Intronic
1151638185 17:75367770-75367792 CTTTGAGGCCGAGGAAATATTGG - Intronic
1155557500 18:27036634-27036656 CTTAGAGATTTAGAATATACTGG - Intronic
1155811561 18:30242270-30242292 GTTAGAGGATGAGTACATACAGG - Intergenic
1156041292 18:32825880-32825902 CTTAAATGATGAGAAAATATAGG - Intergenic
1156520102 18:37714834-37714856 ATTAGAGGCAGAGAACAGACGGG - Intergenic
1158748494 18:60229107-60229129 GTTAGAGACAGAGAAATTACAGG + Intergenic
1158819040 18:61137038-61137060 TTTGGAGGCTGAAAAAATAGTGG - Intergenic
1164496208 19:28764830-28764852 TTTAGAGGATTAGAAAATCCTGG - Intergenic
1164926958 19:32138401-32138423 CTTAGTGGCTGAGAAAACCGAGG + Intergenic
1166346431 19:42169022-42169044 CTTAGAAGCTGAGGAAACAGTGG - Intronic
1166656926 19:44619046-44619068 CTTAGAAGCTGAGCAGATGCTGG - Intronic
1167704472 19:51071125-51071147 GTTACAGGCTGAGAAAATGGGGG + Intergenic
925619523 2:5777594-5777616 CTTAGAGGCTGACATACTATAGG - Intergenic
925994985 2:9284946-9284968 CTTTCAGGCTGTGAAAACACAGG - Intronic
928072728 2:28233624-28233646 CTTACAAGCTAAGAAACTACTGG + Intronic
928648089 2:33376440-33376462 GTTAGTGGCTGAAAAAATTCAGG + Intronic
930408604 2:50995284-50995306 ATTAGTGGCAGAGAAAAGACAGG + Intronic
930460698 2:51670929-51670951 CTAAAAGATTGAGAAAATACAGG - Intergenic
931237841 2:60426754-60426776 CTTAAAGGCTGGAAAAATAAGGG - Intergenic
933745893 2:85571046-85571068 TTTTGAGGCTGAGAAAACCCTGG - Intronic
935679958 2:105627452-105627474 CCTAGGAGCTGAGGAAATACAGG + Intergenic
935687867 2:105700122-105700144 CTTAGTGGCACAGAAAATAATGG - Intergenic
936013074 2:108937311-108937333 CTTAGGGCCTGAGAGAATGCAGG - Intronic
936766315 2:115852920-115852942 TTTGGAGGCTGTGAAAATAGTGG - Intergenic
938004520 2:127777468-127777490 TTTACAGGTTGAGAAAATAATGG - Intronic
939368887 2:141272067-141272089 TATAGAGGCTGAGAGAAGACAGG - Intronic
940856607 2:158733499-158733521 GTCAGCGGCTGAAAAAATACGGG + Intergenic
941149216 2:161893039-161893061 TTTAGTGACTGAGAAAACACAGG - Intronic
942135019 2:172916602-172916624 CTCAGAGGCTGAGGAAATCATGG + Intronic
943663326 2:190582442-190582464 CTTAGAGGCATATAAAATAATGG - Intergenic
944455338 2:199887748-199887770 CTCAGGGGCAGAGAAAAAACAGG + Intergenic
946336502 2:219040821-219040843 CGTAGAGTCTGAGAAGATGCTGG - Intronic
1169250312 20:4055711-4055733 GTTAGAGGCAGTGAAAATAATGG + Intergenic
1169787254 20:9372235-9372257 CTTGGAGGGTGAGAAGCTACAGG - Intronic
1170225854 20:13991511-13991533 CTTAGAAGCTGAAAAATTCCAGG - Intronic
1170319169 20:15075742-15075764 GTAAGAGGGTGAGGAAATACAGG + Intronic
1171139923 20:22731939-22731961 CTTAGAAGATGAGAAAGTTCTGG - Intergenic
1172808027 20:37627060-37627082 CTAAGAGGCTGAGATATAACCGG + Intergenic
1173185898 20:40839931-40839953 CTTGGAGACTGGGGAAATACGGG + Intergenic
1174431361 20:50472104-50472126 CTTAGAGGGTGAGAGAAGAAGGG + Intergenic
1174786024 20:53433742-53433764 GTTACAGGATGAGAAAAGACTGG - Intronic
1174845418 20:53938642-53938664 CTGAGAGGCTGCTAAAACACAGG + Intronic
1176976073 21:15323695-15323717 CTTGGAGTCTGAGAAAGGACTGG + Intergenic
1177120662 21:17133137-17133159 CCTTGAGGCTGAGGAAACACAGG + Intergenic
1177722442 21:24926010-24926032 CTTAATGCCTGAGAAAAAACTGG + Intergenic
1182097967 22:27638696-27638718 TTTTGAGGCTGAGAAAAGAGAGG - Intergenic
1185349050 22:50324825-50324847 CTTGGATGCTGAGAAGAGACAGG - Intronic
950075481 3:10183916-10183938 CACAGTGGCTGAGAAAAGACAGG + Intronic
950657924 3:14448821-14448843 CTTAGAGGCTGATCAAAAATAGG + Intronic
951659445 3:25046326-25046348 AATAGAGACTGAGAAACTACAGG + Intergenic
951844826 3:27073941-27073963 ATGAGAGGCTGAGAAAGTATAGG + Intergenic
952190495 3:31018042-31018064 CTTAGTGGTTGAGAAAATTGAGG + Intergenic
952368080 3:32692402-32692424 GTTAGAGTTTAAGAAAATACAGG - Intronic
952909541 3:38170648-38170670 ATTAGAGGCAGAGCCAATACTGG + Intronic
952990293 3:38825796-38825818 ATTAGAGAGGGAGAAAATACAGG - Intergenic
953137801 3:40198363-40198385 ATTGGAGGTTGAGAGAATACTGG + Intronic
954096894 3:48335635-48335657 CTTAGAATCAGAGGAAATACCGG - Intergenic
954189221 3:48944600-48944622 TTTAGAGGCTGAGAATATTTAGG + Intronic
954979575 3:54732656-54732678 CTGAGAGAATGAGAAAGTACTGG - Intronic
956050980 3:65248348-65248370 CTGAGAGGGAGAGGAAATACAGG + Intergenic
956283797 3:67587191-67587213 CTGAGAGGCTGAGACAGAACTGG + Intronic
957006994 3:74960888-74960910 CTTACAGCCTGACAAAATTCAGG - Intergenic
957568523 3:81915938-81915960 CTGGTATGCTGAGAAAATACAGG - Intergenic
958072191 3:88628513-88628535 CTTAGAGACTGACAAATAACAGG + Intergenic
958509451 3:95027317-95027339 CATAGATGCAGAGAAAATATGGG + Intergenic
958684566 3:97376959-97376981 CTTAGACACTGAGCTAATACAGG - Intronic
960008521 3:112807387-112807409 CTGAGAGGCTTATAAAACACTGG - Intronic
961924066 3:130457989-130458011 CTGAGAGGCTGGGAAAAGTCAGG + Intronic
963337863 3:143998087-143998109 CTTATAGGCTGTGCCAATACTGG + Intronic
965916865 3:173859349-173859371 CTGAGAGGCAGAAAAAATAATGG - Intronic
966099825 3:176253762-176253784 AACAGAGGCAGAGAAAATACAGG - Intergenic
966334448 3:178852750-178852772 CTCAGAGGCTCAGCTAATACTGG - Intergenic
966753239 3:183342540-183342562 CGAAGAGTCTGAGAAACTACAGG - Intronic
966930896 3:184674824-184674846 CTTTGAGGGTGAGAAATTCCCGG - Intronic
967534965 3:190591553-190591575 ATTAGAGTCCCAGAAAATACAGG - Intronic
967714837 3:192750670-192750692 CTTAATGGCTGAGAAGATACTGG - Intronic
969585393 4:8088402-8088424 CTCACAGGCTGAGGAAATGCAGG + Intronic
970409941 4:15795161-15795183 GTAAGATGCTGAGAAAAAACAGG + Intronic
971114804 4:23632409-23632431 CTAAGATTCTGAGAAAATTCAGG + Intergenic
972118245 4:35665720-35665742 CTGAGAGGCTTTCAAAATACTGG - Intergenic
972285932 4:37648326-37648348 CTTTGAGGCTGAGAAGGAACAGG - Intronic
974268131 4:59612433-59612455 CTTTGAGCCTGAAAAAATTCTGG - Intergenic
977111974 4:92968206-92968228 CTTAGAGGTTGTGAAAATTAGGG - Intronic
978462530 4:108972515-108972537 CTTGGAATCTGAGAAAAGACAGG + Intronic
978625890 4:110684679-110684701 CTTACAGACAGAGAAAAGACAGG + Intergenic
980614109 4:135195411-135195433 CTCAGAAGCTGAGCAAATGCTGG + Intergenic
980890395 4:138808636-138808658 ATCAGAAGCAGAGAAAATACTGG - Intergenic
981235183 4:142407031-142407053 CTTAGAGTTTTAAAAAATACTGG + Intronic
982626765 4:157777143-157777165 CTTGCGGGCTGTGAAAATACAGG - Intergenic
982639815 4:157944441-157944463 CTTAAAGGCTGAGAAGTTCCAGG + Intergenic
983012619 4:162565857-162565879 CTTAGAGGCAGAGATTATCCTGG + Intergenic
983168777 4:164512308-164512330 ATTAGAGTCTCAGAAAATACTGG - Intergenic
983561779 4:169108855-169108877 CTTAGAGGCTGAGAAAATACTGG + Intronic
984109568 4:175595657-175595679 CTCAGAAGCTGAGAAGATAGCGG + Intergenic
984388298 4:179093207-179093229 CTGAAAGGCAGAGAAAAAACAGG - Intergenic
984577787 4:181472088-181472110 CTTGGAAACTGAGAAAATAGTGG - Intergenic
984685240 4:182659611-182659633 CTTAGAGACTGACTAAATACGGG - Intronic
986519366 5:8597551-8597573 CTAAAAAGCTGAGAAAATATAGG - Intergenic
987327584 5:16826307-16826329 TTTACAGACGGAGAAAATACTGG - Intronic
987599955 5:20054919-20054941 GTTAGAGGATGAGAAAAGACAGG + Intronic
987862875 5:23508162-23508184 CTTTGAGGCTGAGGAAATTCTGG - Intronic
988052086 5:26043604-26043626 ACCAGAAGCTGAGAAAATACTGG - Intergenic
988481743 5:31637610-31637632 TACAGAGGCTGAGAAAACACGGG + Intergenic
990941050 5:61203575-61203597 CTTAGATGGTGGGAAAATAATGG - Intergenic
993771011 5:91926240-91926262 CTTTGAGGCTGAGAGAGTTCAGG + Intergenic
994538953 5:101070023-101070045 CTTTGGTGCTAAGAAAATACTGG + Intergenic
995088123 5:108139696-108139718 GTTAGAAGCTGAGAGAATGCAGG - Intronic
995368105 5:111386646-111386668 TTTATAGGATGAAAAAATACAGG - Intronic
995802573 5:116014353-116014375 CTTGGAGGCAGAGAAAATGAAGG + Intronic
998763523 5:145458692-145458714 CTGACAGGTAGAGAAAATACTGG + Intergenic
999852907 5:155562206-155562228 CTTAGAGCCTGAGAAAAAGAAGG - Intergenic
1000027408 5:157371403-157371425 GTTAAAGGTTAAGAAAATACTGG + Intronic
1001055755 5:168448433-168448455 CTAAGAGTGTTAGAAAATACAGG + Intronic
1001530170 5:172455760-172455782 CTTACTGGCTGTGAAAACACTGG - Intergenic
1003861474 6:10326164-10326186 CTTATGGCCTGAGAAATTACAGG + Intergenic
1006502634 6:34468130-34468152 CTTAGAGGCTGAGGAAGGCCTGG - Intronic
1008181513 6:48335892-48335914 CATAGAGGCTGGGAAATTACAGG - Intergenic
1009629756 6:66180270-66180292 CATAGAGGGAGTGAAAATACTGG - Intergenic
1010003354 6:70970283-70970305 CTCAGAAGCTGAGAAGATGCCGG - Intergenic
1010896377 6:81369903-81369925 CATAGATGCTGAGCATATACTGG + Intergenic
1012136523 6:95563936-95563958 CTGAGAGACAGAGAAAGTACTGG + Intergenic
1014224605 6:118833510-118833532 CTGAGAGGCGGAGAAAATCCAGG + Intronic
1015636430 6:135279446-135279468 GTAGGAGGTTGAGAAAATACAGG + Intergenic
1015994028 6:138979593-138979615 CTGAGAGGCTGAGAACATGTGGG - Intronic
1016125564 6:140398678-140398700 CCTAGGGGATGAGAAAATGCAGG + Intergenic
1016950686 6:149576928-149576950 CTTAGAAGCTGAGCAGATGCTGG - Intronic
1018707322 6:166472333-166472355 GTGAGAGGCAGAGGAAATACAGG + Intronic
1020517056 7:9135588-9135610 CTTATGGGCTAAGGAAATACAGG - Intergenic
1021379315 7:19948332-19948354 CCTAGAGGCTGAGCAGATGCTGG + Intergenic
1022176411 7:27875547-27875569 CTTAGATGAAGAGAAAAAACAGG - Intronic
1023687290 7:42749562-42749584 CTGAGAGTCTGAGAAATAACTGG - Intergenic
1025725175 7:64051734-64051756 CCTAGAGACTGAGAAAAGACTGG + Intronic
1025754250 7:64320615-64320637 CCGAGAGACTGAGAAAAGACTGG + Intronic
1030320167 7:108158317-108158339 CTTAGGGGCTGAGATAATAAAGG + Intronic
1034193617 7:149229375-149229397 CTGAGAAGTTGGGAAAATACTGG + Intergenic
1034690415 7:153009265-153009287 ATTAGAGAATGAGAAAGTACTGG + Intergenic
1035545582 8:479837-479859 TGAAGAGGCTCAGAAAATACGGG + Intergenic
1036493356 8:9248028-9248050 CCTAGATGCAGAGAAAATCCAGG - Intergenic
1036805089 8:11826064-11826086 CTCTGAGGCTGAGAAAAGACGGG - Exonic
1038853684 8:31307192-31307214 CCTAGAGGCTGAAAAAGTCCTGG + Intergenic
1039291931 8:36105674-36105696 CTTAGAGACAGAAAACATACTGG + Intergenic
1039828913 8:41197454-41197476 CACAGAGGCTGAGAATACACTGG + Intergenic
1040869658 8:52087710-52087732 CTTTGAGGCTAGGCAAATACAGG + Intergenic
1041524472 8:58789827-58789849 TCTAGAGGCAGACAAAATACTGG + Intergenic
1044689485 8:94862320-94862342 CTTAAAGGCTAAGAAATTACTGG - Intronic
1045177002 8:99736252-99736274 CTTAGAGGTGGAGAAATTAGAGG + Intronic
1045736505 8:105301965-105301987 CTGTGAGCCTGAGAAAATAGGGG + Intronic
1045951380 8:107855188-107855210 TTTAGAATCTCAGAAAATACTGG + Intergenic
1047428168 8:124765771-124765793 CTGGGAGGCTGAGGAAAGACAGG - Intergenic
1047761746 8:127959748-127959770 CAAAGAGGCTGAGAACAAACCGG + Intergenic
1047803207 8:128331288-128331310 ATGAGAGGATGAGTAAATACAGG - Intergenic
1049737880 8:144219568-144219590 CATAGAAGCTCAGAAAAGACAGG - Intronic
1050000856 9:1075491-1075513 CTTACAGGCTATGAAACTACTGG - Intergenic
1051880962 9:21839582-21839604 CATAAAGACTGAGAGAATACTGG + Intronic
1052122598 9:24737409-24737431 AATAGAGGCTGTGAAAATCCTGG + Intergenic
1053452672 9:38206242-38206264 CTCAGAGGCTGAGAGAAGCCTGG - Intergenic
1053488867 9:38484878-38484900 CTTAGAGGCTGATAATTTTCTGG + Intergenic
1053719984 9:40935709-40935731 TTTTGAGGCTGAGAAATAACTGG + Intergenic
1057669215 9:97074164-97074186 CTTAGAGGCTGATAATTTTCTGG + Intergenic
1058318608 9:103600956-103600978 CAGAGAGGGTTAGAAAATACAGG + Intergenic
1058362733 9:104169224-104169246 CTTAGAGGCTGACAAGATAAGGG - Intergenic
1058839605 9:108893322-108893344 CAAGGAGGCTGAGAAAACACTGG - Intronic
1062159838 9:135074251-135074273 CTTAGCTTCTCAGAAAATACAGG + Intergenic
1062634308 9:137481999-137482021 CTTAGAGGCACACAAAATAAGGG + Intronic
1185939098 X:4294259-4294281 CATACAGGGTGAGAGAATACAGG - Intergenic
1186684705 X:11913344-11913366 CTCAGAGGTTTACAAAATACCGG + Intergenic
1188552125 X:31375959-31375981 CCAACAGGATGAGAAAATACAGG - Intronic
1189803023 X:44709143-44709165 CCCAGAGGCTGAGACAATCCTGG + Intergenic
1190798330 X:53764762-53764784 CTTAGAGCCAGAGATAATAGAGG + Intergenic
1191607244 X:63076221-63076243 CTTGGAGGCTGTGGAAATTCTGG - Intergenic
1193748022 X:85307409-85307431 CTTAAAAGTTAAGAAAATACGGG + Intronic
1194034177 X:88851089-88851111 ATTAGAGGCTGGGAACATAGTGG + Intergenic
1196642122 X:118074263-118074285 CTTGTAGGTTGAGAAAAAACTGG + Intronic
1197974373 X:132150515-132150537 CATAGAGGCTGTTAAAATGCAGG - Intergenic
1200361866 X:155615341-155615363 CTGAGAGGCTGATAAAACAAAGG - Intronic
1200725220 Y:6661704-6661726 ACTAGAAGCTGAGAAGATACTGG + Intergenic