ID: 983561780

View in Genome Browser
Species Human (GRCh38)
Location 4:169108861-169108883
Sequence GGCTGAGAAAATACTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 292}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561776_983561780 -1 Left 983561776 4:169108839-169108861 CCTACACCTACTAAAGCTTAGAG 0: 1
1: 1
2: 1
3: 4
4: 99
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561773_983561780 18 Left 983561773 4:169108820-169108842 CCAGTGCCTAGTGCAGGGCCCTA 0: 1
1: 0
2: 2
3: 22
4: 160
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561775_983561780 0 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561772_983561780 19 Left 983561772 4:169108819-169108841 CCCAGTGCCTAGTGCAGGGCCCT 0: 1
1: 1
2: 7
3: 40
4: 286
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561774_983561780 12 Left 983561774 4:169108826-169108848 CCTAGTGCAGGGCCCTACACCTA 0: 1
1: 0
2: 0
3: 16
4: 361
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292
983561778_983561780 -7 Left 983561778 4:169108845-169108867 CCTACTAAAGCTTAGAGGCTGAG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG 0: 1
1: 0
2: 0
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561780 Original CRISPR GGCTGAGAAAATACTGGAAG AGG Intronic
903311179 1:22457775-22457797 TTTTGAGAAAATACTGTAAGAGG + Intronic
906305929 1:44719131-44719153 GGGTGAATAAGTACTGGAAGGGG + Intronic
906928427 1:50143992-50144014 TTCTGAGAAAATGCTGGAATAGG - Intronic
907548649 1:55285425-55285447 GGGTGCTTAAATACTGGAAGGGG + Intergenic
908616040 1:65923901-65923923 GGCAGAGAAAATATTTGAAGAGG - Intronic
909895906 1:81068840-81068862 TCCTGAGAAAATATTGTAAGAGG - Intergenic
911966965 1:104382626-104382648 AGCTGAGAAAATCTGGGAAGGGG - Intergenic
913049405 1:115103817-115103839 GGCAGAGAGAATACTGCAGGAGG + Intergenic
914913427 1:151803950-151803972 GGCAGAGGAAGTACTGGAATTGG + Intronic
915447453 1:155982048-155982070 GGCTAAAAAAAGGCTGGAAGAGG + Intronic
916175074 1:162031309-162031331 GGTTGAGAAAAGGCTGGGAGAGG + Intergenic
916646766 1:166794322-166794344 GGGTGAGAAAAAGCTGGGAGGGG + Intergenic
917823650 1:178793302-178793324 TTCTGAGAAATTCCTGGAAGTGG + Intronic
918357321 1:183717714-183717736 GGCTGATAAACTAGTGGAGGAGG + Intronic
919199275 1:194332333-194332355 TTGTGAGAAAATACTTGAAGTGG - Intergenic
921208621 1:212872657-212872679 GGCTGAGAATATACACGAAAAGG - Exonic
922387239 1:225099219-225099241 GAATGAGATAATAGTGGAAGTGG + Intronic
922421454 1:225463423-225463445 AGCTGAGAACACAGTGGAAGGGG + Intergenic
922746082 1:228044953-228044975 GGCTGAGAAAACCCTGGAGCAGG - Intronic
1065428074 10:25626477-25626499 GGCTAAGAAAATTATGGAAATGG + Intergenic
1065985075 10:30942233-30942255 GGCTGAGATTATACTGTAAGAGG + Intronic
1066716831 10:38295843-38295865 GGCTTAATAAATAGTGGAAGGGG + Intergenic
1067672982 10:48342734-48342756 TGCTGAGACAACACCGGAAGAGG + Intronic
1067962986 10:50877819-50877841 GTCTTAGAAAAAACTGAAAGAGG + Intronic
1068144381 10:53048130-53048152 GGCTGAGAAAATGATGAAAGAGG + Intergenic
1069252548 10:66287878-66287900 GGCTGAGGAAATAGTGGAGTTGG + Intronic
1069553982 10:69384646-69384668 GGCTGAGAAGATTCTGGAAAAGG + Intronic
1069862752 10:71481664-71481686 AGCTGGGAAATTACTGGACGTGG + Intronic
1071010546 10:80935336-80935358 GGCTGAGAAGAAAGAGGAAGAGG - Intergenic
1072969647 10:100006500-100006522 GGTTGAGAATAGACAGGAAGAGG - Intronic
1073009295 10:100347279-100347301 GGCTGAGGAAATACCGGACACGG + Exonic
1073588423 10:104732961-104732983 GGCTGAGCAAACAGTGGAGGTGG + Intronic
1073998518 10:109343216-109343238 GGCTGTGAAATGACTGAAAGGGG + Intergenic
1074078269 10:110149136-110149158 GGCTGGGCAAATACTGGCAATGG - Intergenic
1074723809 10:116286961-116286983 GGCTGATAAGAAACCGGAAGTGG + Intergenic
1074880411 10:117652769-117652791 AGCAGAGAGAATTCTGGAAGGGG - Intergenic
1075295166 10:121268754-121268776 GGATGAGATAAAGCTGGAAGGGG + Intergenic
1075585324 10:123653210-123653232 GGGTGAAAAAATACTTGCAGTGG + Intergenic
1075685703 10:124363954-124363976 GGACGAGAGAATAATGGAAGGGG - Intergenic
1076040543 10:127243995-127244017 GCATGAGAAAATAATTGAAGAGG - Intronic
1076117380 10:127909588-127909610 CACTGGGAAAGTACTGGAAGGGG - Intronic
1076748219 10:132525094-132525116 GGCTGGGAACAAGCTGGAAGAGG + Intergenic
1077427020 11:2485626-2485648 GGATGAGAAAATTCTAGAAATGG - Intronic
1077636936 11:3848679-3848701 TGCTGAGAAAGTATTGGAAAAGG - Intergenic
1077805056 11:5581821-5581843 GACTAAGCCAATACTGGAAGGGG + Exonic
1078100835 11:8329392-8329414 AGCTGAGAAAATGCAGGCAGGGG - Intergenic
1078315122 11:10288451-10288473 TGCTGAGAAAATACTTGCTGGGG - Intronic
1079877277 11:25875666-25875688 GTCTGAGAAGTCACTGGAAGGGG + Intergenic
1080084870 11:28267374-28267396 GTCTCAGCAAATACTGGAAGGGG - Intronic
1080930567 11:36805752-36805774 GGCTGAGGAAATGATGGATGTGG - Intergenic
1081046866 11:38285233-38285255 GGCTGCCACAAAACTGGAAGTGG - Intergenic
1084943983 11:72629151-72629173 GGCAGAGAAAATACAGGGATAGG + Intronic
1089532088 11:119136809-119136831 GGCTTAGAAAGTACTGGACCAGG + Intergenic
1090790172 11:130085684-130085706 GGATGAAAAAGTACTGGAAATGG - Intronic
1092097549 12:5855964-5855986 TTCTGACAAAATACTGAAAGTGG + Intronic
1092203186 12:6599946-6599968 GGGTGAGGAGATCCTGGAAGAGG - Exonic
1092824881 12:12389488-12389510 GGCTTAAAAGATACTGGCAGAGG - Intronic
1093223423 12:16450548-16450570 GAGTGAGAAAATACTGTAACAGG + Intronic
1093367653 12:18323470-18323492 GGGTCAGAACATAATGGAAGTGG - Intronic
1094095374 12:26698251-26698273 GGCAGAGAAAACAGTGGTAGGGG + Intronic
1096186999 12:49587936-49587958 GGCTGAGGAGCTGCTGGAAGAGG + Intronic
1096724777 12:53552758-53552780 GAGGGAGAAAAAACTGGAAGAGG + Intronic
1098933733 12:76452542-76452564 GCCTGAGAAAGTAGTGGGAGGGG - Intronic
1100118717 12:91342558-91342580 GACAGAGAAAATACTTGAACAGG - Intergenic
1100194559 12:92229735-92229757 GGCTGAGGAAAAAATAGAAGTGG - Intergenic
1102798925 12:115714629-115714651 GGAAGAGAAAATTCGGGAAGTGG + Intergenic
1102862194 12:116345597-116345619 GGCTGTGAAAAAGATGGAAGAGG + Intergenic
1103395025 12:120600719-120600741 GTCTGGGAAAATCCTGGAACTGG - Intergenic
1103601312 12:122056396-122056418 GCCTGTGAAAATGGTGGAAGAGG - Intronic
1104617554 12:130283291-130283313 GGCTGGGAATAGGCTGGAAGAGG + Intergenic
1104765016 12:131324556-131324578 GGCTGAGCAAATACAGGAAATGG - Intergenic
1105616104 13:22014221-22014243 GGCTGAGGGAAGACTTGAAGGGG - Intergenic
1105830861 13:24161838-24161860 GACAGAGAAAATGCTGGCAGGGG - Intronic
1106539756 13:30679856-30679878 GCTTGAGAACATACTGGAAAAGG - Intergenic
1108030268 13:46221914-46221936 GGCTGAGATTGTACTGGGAGTGG + Intronic
1109794552 13:67293015-67293037 AGATGAGATAATACTGGAATAGG - Intergenic
1110406134 13:75152276-75152298 GTGTGAGAAAATAATGGAGGTGG - Intergenic
1112108092 13:96264243-96264265 GGCTGTGCAAATACCAGAAGAGG + Intronic
1112347105 13:98598997-98599019 GGTGGAGAATCTACTGGAAGGGG - Intergenic
1114337630 14:21708473-21708495 AGATGAGAAAATATTGGAGGAGG + Intergenic
1116476607 14:45347743-45347765 GCCAGAGCAACTACTGGAAGAGG - Intergenic
1117367718 14:55047341-55047363 GGCTTAGAAAAAAATGGGAGTGG - Exonic
1117479025 14:56124932-56124954 GGCTTATAAGATATTGGAAGGGG + Intronic
1118360959 14:65055976-65055998 GGAGGAAAAAAAACTGGAAGAGG - Intronic
1118828008 14:69401550-69401572 GTTTGAAAAAATACTGGAATTGG - Intronic
1120117424 14:80636526-80636548 GGCAGAGAGAAAACTAGAAGAGG - Intronic
1121378178 14:93432879-93432901 GGAAGAGAAAACACAGGAAGAGG - Intronic
1121655863 14:95595126-95595148 TGGTGAGAAACCACTGGAAGTGG - Intergenic
1121983044 14:98471480-98471502 GGAGGCAAAAATACTGGAAGAGG + Intergenic
1122304467 14:100753290-100753312 GGATGAGAAAAACCTGGAATGGG - Intergenic
1124384936 15:29199274-29199296 AGATAAGAAAGTACTGGAAGAGG + Intronic
1125028448 15:35053361-35053383 GACTGAAAGATTACTGGAAGGGG - Intergenic
1126410333 15:48367203-48367225 GGGAGGAAAAATACTGGAAGGGG - Intergenic
1126821787 15:52511628-52511650 GGCTTCCAAAATACTGGAATGGG + Intronic
1127349454 15:58136056-58136078 GGGAGAGGAAATCCTGGAAGAGG - Intronic
1127591100 15:60424386-60424408 GGGGAAGAAAAAACTGGAAGGGG + Intronic
1127985073 15:64063207-64063229 GGCTTAGGATATACCGGAAGAGG - Intronic
1128191878 15:65708719-65708741 TGCTCAGAAAACACTGGAAAGGG + Intronic
1128471340 15:67956383-67956405 GGGTGAGAAAAGATTGGAAATGG - Intergenic
1128910255 15:71507511-71507533 AGCTGAGAACATACCAGAAGGGG - Intronic
1129983331 15:79894773-79894795 AGGTTAGAGAATACTGGAAGGGG - Intronic
1130029364 15:80297743-80297765 GGATGAGAAAAGAGGGGAAGGGG + Intergenic
1131218900 15:90564465-90564487 GGCAGAGAAAATAATAGAGGAGG - Intronic
1131864874 15:96697262-96697284 GGCTGAGAATGTAATGGATGAGG + Intergenic
1132261414 15:100428340-100428362 GGATGAGAAGACACTGGCAGTGG + Intronic
1132697859 16:1209929-1209951 GGCTGAGAAGGTGCTGGGAGGGG + Intronic
1133107112 16:3519206-3519228 GGCTGAGTAAAGAAGGGAAGGGG - Intronic
1133746626 16:8691947-8691969 TCCTGTGAAAACACTGGAAGGGG - Intronic
1134844779 16:17430611-17430633 GGTTGGGAAAATACAGGGAGAGG - Intronic
1137511749 16:49106848-49106870 GGAAGAGAATATCCTGGAAGGGG - Intergenic
1140419505 16:74807066-74807088 GGCTCAGAAGAGACCGGAAGTGG + Intergenic
1141591888 16:85074672-85074694 GGCTAAGAAACCACTGAAAGAGG + Intronic
1141724847 16:85781063-85781085 AGCTGAGAGAAAACTGCAAGAGG + Intronic
1143352247 17:6297526-6297548 AGCTGAGCAAACCCTGGAAGAGG - Intergenic
1144227562 17:13164921-13164943 GGCTGAGAATGTAGTGGGAGGGG + Intergenic
1144714186 17:17422711-17422733 GCCTGAAAAAAGACAGGAAGAGG + Intergenic
1145184727 17:20784420-20784442 GGCTGAGGAAATACCGGACACGG + Intergenic
1146544225 17:33724543-33724565 TGCTGTGTAAATGCTGGAAGTGG + Intronic
1148564903 17:48626869-48626891 GCCCGAGAGGATACTGGAAGAGG + Intronic
1150223381 17:63509561-63509583 GCCAGAGAAAATGTTGGAAGAGG + Intronic
1150656068 17:67040620-67040642 AGCTGAGATCATACTGGGAGGGG - Intergenic
1151364187 17:73606414-73606436 TGGTGAGTAAATGCTGGAAGGGG + Intronic
1152433484 17:80261628-80261650 GTCAGAGAAAAGACAGGAAGCGG + Intronic
1153988054 18:10370021-10370043 GTTTGAGAAAAAACTGAAAGTGG - Intergenic
1156041753 18:32830938-32830960 GGCTGAGAATACTGTGGAAGAGG + Intergenic
1156597891 18:38568871-38568893 GGATGAGAAAATGCAGTAAGGGG - Intergenic
1160063795 18:75555942-75555964 GTCTCAGAAAAGAATGGAAGCGG + Intergenic
1160827485 19:1087451-1087473 AGATGAGAAAATTCTGGAGGTGG - Exonic
1161434460 19:4254411-4254433 GGCTGAGAAGCTCCTGGAGGAGG + Exonic
1164464668 19:28477178-28477200 TGCATAGAAAATTCTGGAAGAGG - Intergenic
926746762 2:16165012-16165034 GGCTGGGAATATTCTCGAAGTGG + Intergenic
927059393 2:19401219-19401241 GGCTTTGAAGATAATGGAAGAGG - Intergenic
927078159 2:19601026-19601048 GGATCAGAAAAAACTGGAATAGG + Intergenic
928007587 2:27577538-27577560 CTCTGAGAAAAGACTGCAAGGGG + Exonic
928128919 2:28635103-28635125 GGCTGAGATAATAATGGCTGGGG - Intronic
928132749 2:28664897-28664919 GGGTCAGACAATTCTGGAAGAGG - Intergenic
928150637 2:28825494-28825516 GGCTGAGAAAATATTTAACGAGG - Intronic
928925981 2:36579798-36579820 TGCTGAGAAAAGACTGAAATGGG - Intronic
931109364 2:59093301-59093323 GCCTGAGAAAGTACGGCAAGGGG - Intergenic
931233614 2:60395037-60395059 GGCTAAGGAAAGCCTGGAAGAGG + Intergenic
932371254 2:71190071-71190093 GGTGGAGGAAAAACTGGAAGGGG - Intronic
932696040 2:73957335-73957357 GGTTCAGAATATACTGGAAATGG + Intronic
933462989 2:82612848-82612870 GGCTGAGAAAATACAAGCATAGG - Intergenic
934169570 2:89329166-89329188 CACTGAGAAAATACAGGATGAGG - Intergenic
934197722 2:89853419-89853441 CACTGAGAAAATACAGGATGAGG + Intergenic
935312579 2:101799988-101800010 GGCTGAGATAATCCTACAAGAGG - Intronic
935336527 2:102021974-102021996 AGCAGAGCAATTACTGGAAGAGG - Intronic
935464876 2:103384461-103384483 AGCTAAGAAAAGCCTGGAAGAGG - Intergenic
936029839 2:109062416-109062438 GGCTTAGAAACTAGTGGAAGAGG - Intergenic
937098128 2:119248849-119248871 GGCTGAGAACAGACTGTAGGAGG + Intronic
940780921 2:157932923-157932945 GACTGAGAAAAGTCTGGAGGCGG - Intronic
940794876 2:158066823-158066845 GACTGAGAAAAGAATGGGAGGGG + Intronic
941543045 2:166810844-166810866 GACTGAGAATATTCTGGAATTGG + Intergenic
941959548 2:171239982-171240004 GACTGAGAAAACACTTGAATGGG - Intergenic
942161800 2:173196643-173196665 GGCTGAGGAAATAGTGGATATGG + Intronic
942231025 2:173860972-173860994 GGCTGAGGATTTCCTGGAAGGGG + Intergenic
942381455 2:175395641-175395663 GGCTGAGAACAAACTAGAAGTGG - Intergenic
943370580 2:187010953-187010975 GGCTGAGATAAGAGTGGAAAGGG - Intergenic
944778907 2:202997396-202997418 GGATGAAAAAATTCAGGAAGTGG - Intronic
946628761 2:221643975-221643997 GGCTGAATAAATACAGAAAGTGG - Intergenic
947368168 2:229417773-229417795 GGCTGTGAAAACTGTGGAAGAGG - Intronic
947455093 2:230246795-230246817 GGTGGAGAAAATACTGTGAGAGG + Intronic
949020032 2:241735592-241735614 GGCTGAGAACAACCTGGATGGGG + Intronic
1172768211 20:37362441-37362463 AGCTGAGGAGAAACTGGAAGAGG - Intronic
1173017940 20:39243872-39243894 GGCTGAGAAATATCTGGATGTGG + Intergenic
1173678522 20:44859400-44859422 GGCTGACAAAAAAATGGAAACGG + Intergenic
1175141623 20:56864955-56864977 GGCTCAGAATATACAGAAAGTGG - Intergenic
1175190188 20:57206579-57206601 GGCAGAGAAAATACTAGAGGGGG + Intronic
1175711162 20:61222152-61222174 GGCTGTGAAGATGCAGGAAGGGG + Intergenic
1175775412 20:61650094-61650116 GGAGGAGAATACACTGGAAGAGG - Intronic
1177459403 21:21390449-21390471 AGCTGAGAATAGACTGAAAGGGG + Intronic
1178254930 21:31043853-31043875 AGCTGAGCCAATCCTGGAAGGGG + Intergenic
1180051561 21:45333831-45333853 CCCTGAGAAAAGACTGGAGGAGG - Intergenic
1182764729 22:32750630-32750652 TGCTGAGAATATACTGAAACAGG + Intronic
1183138892 22:35917229-35917251 GGAAGAGAAAGTACTGAAAGGGG + Intronic
949157085 3:841914-841936 GGCTTTGAAAATGGTGGAAGAGG + Intergenic
949489270 3:4572306-4572328 TACTGAGAAAAGACTGGGAGAGG - Intronic
949616550 3:5760014-5760036 TGCTGAGGCAATCCTGGAAGGGG - Intergenic
952283185 3:31943004-31943026 GGCTGAGGAAAGATTGGAATGGG - Intronic
952406316 3:33008323-33008345 GGCTGACAAAATGCAGGTAGAGG + Intronic
952450832 3:33431315-33431337 GGCTGAGCAAATTCTAGAACTGG + Intronic
952535184 3:34301797-34301819 GGGTGGGAAATTACTGAAAGGGG - Intergenic
952903152 3:38122548-38122570 GGCTGAGACCATTGTGGAAGGGG - Exonic
954435918 3:50496094-50496116 GGCTGGGCAAACACTGGCAGTGG - Intronic
955960841 3:64339992-64340014 GGATGGGTAAATAATGGAAGTGG - Intronic
956009517 3:64815915-64815937 GGCTCAGGAAATACTAGAATAGG + Intergenic
956277261 3:67515998-67516020 GGCTGAGAGGATACAGGAAGAGG - Intronic
956282641 3:67574073-67574095 GGCTTTGAAAATGGTGGAAGGGG - Intronic
956674849 3:71724647-71724669 GGATGAGGAAGAACTGGAAGAGG + Intronic
958896654 3:99836966-99836988 GTCTGAGAAAAACCTGGAATAGG + Intronic
959658786 3:108842074-108842096 GGGTGTGAACATACTGCAAGTGG - Intronic
960909435 3:122634217-122634239 GGCTATGAAAATATAGGAAGGGG - Intronic
961584822 3:127913690-127913712 GGATGAAAAAATTCTGGAAATGG + Intergenic
962374653 3:134850033-134850055 AGTTGAGAAACTCCTGGAAGAGG - Intronic
962865007 3:139441321-139441343 GCCTGAGAAATCACTGAAAGGGG - Intergenic
963678611 3:148346346-148346368 GGCTGAGACAATTCCTGAAGAGG + Intergenic
964268870 3:154933201-154933223 GTGTGAGAACAAACTGGAAGGGG + Intergenic
965338441 3:167456648-167456670 GGCTGAGCCAATACTAGAAGAGG - Intronic
965820668 3:172681148-172681170 GGATGAGGAAAAAGTGGAAGTGG + Intronic
967628652 3:191716245-191716267 GGCTTTGAAAATAGAGGAAGGGG - Intergenic
970729491 4:19086560-19086582 GGCAGAGACAAAACTGGGAGAGG - Intergenic
971688355 4:29801075-29801097 GGCTGAGAGACTTCTGGAACGGG + Intergenic
971819689 4:31535520-31535542 AGCTGACATCATACTGGAAGGGG - Intergenic
972503540 4:39698733-39698755 GCCTGAGAAAACCCGGGAAGTGG + Intronic
974225058 4:59031211-59031233 AACTGAGAAAAAAATGGAAGTGG - Intergenic
976959512 4:90951485-90951507 GGCGGAAAGAATACTGCAAGGGG + Intronic
978638474 4:110840301-110840323 GGCTAAGAAAATGCTTGAACTGG - Intergenic
980394151 4:132187125-132187147 AGCTAAGAAAATACAGGAATAGG - Intergenic
980589025 4:134858692-134858714 TGCTGACAAAATACTAGCAGAGG - Intergenic
980981140 4:139655482-139655504 GGCTGAGAAAGAACAGGAAAAGG - Intergenic
982585533 4:157232299-157232321 GGCAGAGAAAGATCTGGAAGTGG + Intronic
983561780 4:169108861-169108883 GGCTGAGAAAATACTGGAAGAGG + Intronic
983564520 4:169135199-169135221 GGCTGAGAAAAAAATGGCAAGGG + Intronic
987638514 5:20579131-20579153 GGCTCAGAAAATACTTGAGAAGG + Intergenic
988685062 5:33517979-33518001 GGGTGAGGCAAAACTGGAAGAGG + Intergenic
991952759 5:71962760-71962782 GGCTGAGAGAAAGATGGAAGTGG + Intergenic
992112736 5:73511486-73511508 AGCTAAGAAAATAATGGAGGGGG - Intergenic
993128394 5:83863801-83863823 GGCTGAGAAAAAATTGTAAAAGG - Intergenic
994188998 5:96846714-96846736 GGTGGAGAAAATGCTGGGAGGGG - Intronic
994255067 5:97582888-97582910 TGGTCAAAAAATACTGGAAGCGG + Intergenic
995939477 5:117563712-117563734 AACTTGGAAAATACTGGAAGAGG - Intergenic
997643625 5:135466061-135466083 TGCTGAGAATATCCAGGAAGGGG - Intergenic
997755854 5:136398836-136398858 GGCTGAGCAAATACTCAGAGGGG + Intergenic
998332048 5:141337671-141337693 GGATGAAAAAGTTCTGGAAGTGG + Intronic
998470883 5:142382831-142382853 GGCTGAGCAAAGAGTGGAGGAGG - Intergenic
999054045 5:148554605-148554627 TGATGAAAAAATTCTGGAAGTGG + Intronic
1000513744 5:162214944-162214966 GGCAGAGTAAATAACGGAAGGGG + Intergenic
1001010129 5:168089966-168089988 GCCTGAGAAAATCCTGAATGAGG - Intronic
1002857854 6:1054414-1054436 GGCTGAGAAGATGCTAGAAATGG - Intergenic
1003047779 6:2750201-2750223 AGCGGAGAAAATGCTCGAAGAGG - Intronic
1004472377 6:15940855-15940877 GGCTTGGAAGATACAGGAAGGGG - Intergenic
1004909454 6:20268808-20268830 GGCCCTGAAAATGCTGGAAGTGG + Intergenic
1005118442 6:22364156-22364178 GACTGAGAAAAGGATGGAAGGGG + Intergenic
1005522709 6:26614283-26614305 GGCTGAGAATTTGCTGGGAGGGG + Intergenic
1005530409 6:26698760-26698782 TGCTGAGAAACTTCTGGAAATGG + Intergenic
1005540387 6:26802886-26802908 TGCTGAGAAACTTCTGGAAATGG - Intergenic
1005749707 6:28871412-28871434 AGCTGAAAGAATACTGGAAAAGG + Intergenic
1006173408 6:32108262-32108284 GGCATAGAAACAACTGGAAGTGG - Intronic
1008685509 6:53921920-53921942 GGTTAACAAAATACTGGAAGAGG - Intronic
1008741992 6:54620330-54620352 GGCTGAGAGATTACTGGCAGTGG + Intergenic
1009432473 6:63580922-63580944 GCCTGAGAAAAGAATGGGAGGGG + Exonic
1010203261 6:73300720-73300742 GGTTGACTAAATACTGGAAGTGG + Intronic
1011015017 6:82744888-82744910 AGTTGAGAAAACACTGAAAGTGG - Intergenic
1012072500 6:94640391-94640413 CTCTGAGAAAATACTAGAAAAGG + Intergenic
1013296649 6:108763759-108763781 ATCTGAGAAAATACTGGCGGAGG - Intergenic
1014485388 6:121993413-121993435 GGCTGAGAAAATCCTGAAACTGG - Intergenic
1014691145 6:124564927-124564949 GCCTGAAAAAAAAATGGAAGGGG - Intronic
1014853241 6:126367500-126367522 GGCAGAAAACATACAGGAAGTGG + Intergenic
1016273816 6:142324357-142324379 AGCTTAGAAAATACTGGTTGAGG - Intronic
1016986711 6:149900827-149900849 GGCTGAGAAAAAACAGCAAAAGG - Intergenic
1017019978 6:150132372-150132394 GACTGAGAAAGCACTGGCAGGGG + Intergenic
1017052036 6:150402270-150402292 GGGGGAGAAAACACTGGAAGAGG + Exonic
1017837346 6:158190484-158190506 GGTTGAGAAAAGACTGGGAGTGG - Intronic
1018052560 6:160023918-160023940 GGCTGAAAAAGAGCTGGAAGTGG + Intronic
1018914131 6:168122378-168122400 GGCTTAGAAAATCCTATAAGCGG - Intergenic
1020368283 7:7404017-7404039 GGCTGAGAATACACTGCAACAGG - Intronic
1020446023 7:8268860-8268882 GACTGAGTTAAAACTGGAAGAGG - Intergenic
1020576137 7:9931042-9931064 GGATGAGAAAATACAGGATTGGG - Intergenic
1021437779 7:20640972-20640994 GGCTGAGAACACCCAGGAAGAGG - Intronic
1021485288 7:21161119-21161141 GGCTTAGGAAACACTGCAAGTGG - Intergenic
1022024467 7:26433933-26433955 GGGAAAGAAAATATTGGAAGTGG + Intergenic
1026053870 7:66968362-66968384 GGCAAAGAAAATCCTGGAGGTGG + Intergenic
1027557569 7:79685374-79685396 GTAGGAGAAAATAATGGAAGAGG - Intergenic
1028580792 7:92408117-92408139 GGCTTAGAGAACACTGGAGGAGG - Intergenic
1028584494 7:92439611-92439633 GGCTGAGAAAATTCTGGTGGTGG - Intergenic
1028584660 7:92440670-92440692 GACTGAGAAAATTCTGGTGGTGG + Intergenic
1030965043 7:115981304-115981326 GTCTCAGGAAATTCTGGAAGTGG - Intronic
1032038960 7:128542427-128542449 GGCTGAGAATATTCTGTAACTGG - Intergenic
1032385262 7:131518337-131518359 GGCTAATAAAATACTTGAGGTGG + Intronic
1032534815 7:132653970-132653992 GCCTGAGAAGATGGTGGAAGGGG + Intronic
1032803836 7:135337198-135337220 GGGTTAGAGAAAACTGGAAGAGG + Intergenic
1033633428 7:143184368-143184390 GGCTGAGAAGAGCCTGGAAGCGG + Exonic
1033637198 7:143222983-143223005 GGCTGAGAAGAGCCTGGAAGCGG + Exonic
1034477338 7:151293237-151293259 GGCAGAGCAAATACTGAAAAAGG + Intergenic
1035269077 7:157709434-157709456 TGCTGGGAAATTACTGGCAGTGG + Intronic
1035957008 8:4091789-4091811 GGTTGGTAAAATACTGGAAGAGG + Intronic
1036053187 8:5223624-5223646 GCCTTAGAAAATACAGAAAGTGG + Intergenic
1036053286 8:5224327-5224349 TTCTTAGAAAATACTGAAAGAGG - Intergenic
1037164974 8:15816336-15816358 TACTGAGGAAATAATGGAAGGGG + Intergenic
1038372445 8:27007601-27007623 GGCTGAGACATAACAGGAAGAGG - Intergenic
1038434363 8:27524621-27524643 GCCTGAGCAAATTCTAGAAGGGG - Intronic
1039291057 8:36094977-36094999 GGGAGAGAAAAAACTGGAAGTGG - Intergenic
1040425313 8:47279338-47279360 CACTGAGAAAGTACTGGAAGTGG - Intronic
1040551042 8:48437762-48437784 GGCTGAGGAGGAACTGGAAGTGG + Intergenic
1041283591 8:56236905-56236927 TTGTGAGAAAATACTGCAAGGGG + Intergenic
1041799284 8:61781228-61781250 TGCTTTGAAAATACAGGAAGAGG + Intergenic
1041865418 8:62567642-62567664 GGCTTTGAAGATAGTGGAAGAGG + Intronic
1042075393 8:64988310-64988332 GGCTGAGAAAAGATTGGAATTGG - Intergenic
1042236850 8:66621817-66621839 GGCTTTGAAAATAGAGGAAGGGG - Intergenic
1042801432 8:72722238-72722260 GGTGGAGAACAGACTGGAAGGGG - Intronic
1043041106 8:75263049-75263071 AGCTGACAAAATACTGGGTGGGG + Intergenic
1044769615 8:95617504-95617526 AACTGAGAAAATAATGGAACGGG - Intergenic
1044779104 8:95724838-95724860 GGCTGAGAATTTAGTGGAGGTGG + Intergenic
1045736506 8:105301971-105301993 GCCTGAGAAAATAGGGGAACAGG + Intronic
1046119237 8:109824365-109824387 GACTGAGAAAAAAATGAAAGAGG - Intergenic
1047015427 8:120718587-120718609 GGCTCTGAAAATATTAGAAGTGG + Intronic
1047291736 8:123537869-123537891 GGCTTAGAAAAGAGTGGCAGAGG + Intronic
1047988501 8:130261482-130261504 GGCTCGGAAAATACGGGAATGGG + Intronic
1048524302 8:135187264-135187286 GTCCGAGGAAATACAGGAAGGGG + Intergenic
1048838556 8:138544677-138544699 GGCTTTGAAGATATTGGAAGGGG + Intergenic
1051618714 9:19030957-19030979 GGAGGAGAAAATACAGGATGAGG + Intronic
1051880964 9:21839588-21839610 GACTGAGAGAATACTGGGAAAGG + Intronic
1052448395 9:28592977-28592999 GGCTGAGAAGATAATGTAAGTGG - Intronic
1055766285 9:79667162-79667184 GACTGAGTAAACCCTGGAAGTGG + Intronic
1057712998 9:97464195-97464217 GGCTGAGAAAAGTCAGGAAGGGG - Intronic
1057824242 9:98359983-98360005 GGCAGAGAAGATTCTGGAAGGGG + Intronic
1058280832 9:103112028-103112050 GACTGAGAAGAAACAGGAAGAGG - Intergenic
1058473691 9:105307704-105307726 TGCTGAGTAAAAACTGGAAAAGG - Intronic
1060701787 9:125759065-125759087 GGCAGAGAAAGTAGTGGAAATGG + Intronic
1060943057 9:127554379-127554401 GGAAGAGAAAATTCTGGAAGAGG - Intronic
1187498181 X:19814311-19814333 TGTTGAGAAAAGACTGCAAGGGG - Intronic
1187653533 X:21441059-21441081 GGCTTAGATAATATTTGAAGTGG - Intronic
1189786077 X:44559914-44559936 GGCTGAGAAAACACGGAGAGAGG - Intergenic
1190436719 X:50432963-50432985 GGCTGACAAAGTTCTGAAAGTGG + Intronic
1190854038 X:54275311-54275333 GGCTCAGAAAAAAGTGGGAGTGG + Intronic
1192637711 X:72835367-72835389 TGCTAAGAAAAAGCTGGAAGAGG + Intronic
1192644003 X:72885448-72885470 TGCTAAGAAAAAGCTGGAAGAGG - Intronic
1195480418 X:105338512-105338534 GGAGGAGAGAATAGTGGAAGAGG - Intronic
1197586918 X:128359709-128359731 AGCTGATAAAATAATGAAAGAGG - Intergenic
1199460228 X:148075831-148075853 GGCTTTGAAAATAAAGGAAGGGG + Intergenic
1201472747 Y:14351977-14351999 GGCAGAGAAGATTCAGGAAGTGG - Intergenic