ID: 983561781

View in Genome Browser
Species Human (GRCh38)
Location 4:169108874-169108896
Sequence CTGGAAGAGGATGAAACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 307}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561776_983561781 12 Left 983561776 4:169108839-169108861 CCTACACCTACTAAAGCTTAGAG 0: 1
1: 1
2: 1
3: 4
4: 99
Right 983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG 0: 1
1: 0
2: 4
3: 24
4: 307
983561775_983561781 13 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG 0: 1
1: 0
2: 4
3: 24
4: 307
983561778_983561781 6 Left 983561778 4:169108845-169108867 CCTACTAAAGCTTAGAGGCTGAG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG 0: 1
1: 0
2: 4
3: 24
4: 307
983561774_983561781 25 Left 983561774 4:169108826-169108848 CCTAGTGCAGGGCCCTACACCTA 0: 1
1: 0
2: 0
3: 16
4: 361
Right 983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG 0: 1
1: 0
2: 4
3: 24
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561781 Original CRISPR CTGGAAGAGGATGAAACCAG TGG Intronic
900689218 1:3969859-3969881 CTTGAAGTGTATGAAAGCAGTGG - Intergenic
901080042 1:6578974-6578996 CAGGAAGATGGTGAAACCAAGGG - Exonic
902042518 1:13503106-13503128 CTGGAGGAGGCTGACACAAGAGG + Intronic
902767421 1:18626655-18626677 AAGGAAGAGGAAGAAAACAGAGG + Intergenic
902767428 1:18626704-18626726 GAGGAAGAGGAAGAAAACAGAGG + Intergenic
904357160 1:29947789-29947811 ATGGAAGAGGATGAGAAAAGGGG - Intergenic
905474059 1:38213486-38213508 CTGGAAATGGCTGAAACCAATGG + Intergenic
906129012 1:43444957-43444979 CTGGAAGAGAGGGAAACCTGGGG - Intronic
910191555 1:84600962-84600984 CTGGAAGAGGGTGATTCCCGAGG + Intergenic
910226168 1:84938767-84938789 CTGGATGATGATGACCCCAGGGG + Intronic
910612893 1:89164285-89164307 CTGGAAGAAGCTGTAACCTGTGG - Intronic
914965513 1:152253931-152253953 CAGGAAGGAGATGAGACCAGAGG - Intergenic
917630485 1:176886852-176886874 CTGGAAGAGAGTGACCCCAGGGG - Intronic
919759258 1:201087027-201087049 CTGGAATGGGATGATACCAATGG + Intronic
920181539 1:204134906-204134928 CTGGATAGGGAAGAAACCAGAGG - Intronic
920285188 1:204874003-204874025 TTGACAGATGATGAAACCAGAGG - Intronic
920602908 1:207347142-207347164 ATGGAAGAGGAGAAGACCAGAGG + Intronic
920786822 1:209050324-209050346 TGGGAAGAGGCTGAATCCAGGGG + Intergenic
923009370 1:230075906-230075928 CTGGACGAAGATGAAACCAGGGG - Intronic
923362389 1:233224504-233224526 CAGGAAGCGGAAGAAAGCAGTGG - Intronic
924046937 1:240041494-240041516 GTGAAAGAGGAAGACACCAGTGG + Intronic
924240126 1:242032375-242032397 GAGGAAGAGGATGAAGACAGAGG + Intergenic
924261351 1:242234741-242234763 CTGAGAAAGGAAGAAACCAGAGG - Intronic
1062884878 10:1008996-1009018 CAGGAAGAGGATGGAAACTGAGG + Exonic
1063186405 10:3655890-3655912 CAGGAAGAGAGTGAAACCACCGG + Intergenic
1063526356 10:6790022-6790044 CCGGAAGAGGATCAGCCCAGAGG + Intergenic
1063728669 10:8669802-8669824 CTAGAAGAGAAGGAAACCAGGGG + Intergenic
1067080838 10:43211423-43211445 CTGGGAGAGGCTGAACCTAGAGG + Intronic
1067689139 10:48490142-48490164 CTGTAGGGGGATGAAACCAAAGG + Intronic
1067972250 10:50986096-50986118 CTGGGAGAAGATGCTACCAGGGG + Intergenic
1068209660 10:53904585-53904607 CTGGAAGAGGTAGAATCAAGAGG + Intronic
1068582993 10:58763901-58763923 CTGGAAGAGAATAAAGCCAAAGG + Intronic
1069034737 10:63634652-63634674 CTGGAAGTGGAGGAAACAACTGG + Intergenic
1069914132 10:71776806-71776828 CTGGCTGAAGATGAAAGCAGTGG - Intronic
1070656310 10:78274077-78274099 TTTGAAGAAGATGAAAGCAGTGG + Intergenic
1071123572 10:82308919-82308941 CTGGAAGAGAAGGAAAACAGAGG - Intronic
1071566467 10:86673807-86673829 CTAGAAGAGGAGGAAGGCAGGGG + Intronic
1072330525 10:94345177-94345199 CTGGAAAAGAAAGAAACCATAGG - Intronic
1072746765 10:97945540-97945562 CTGGAATAGGATATATCCAGAGG + Intronic
1073783502 10:106864584-106864606 CAGGAAAAGGCTGAATCCAGGGG + Intronic
1075255889 10:120925907-120925929 GTGGAACAGGGTGAAAGCAGCGG + Intergenic
1079166688 11:18050599-18050621 ATGGAAGAGGATCAATCCAAAGG - Intergenic
1079249900 11:18779789-18779811 CGGGAAAAGGATGAATTCAGAGG + Intronic
1079518543 11:21297475-21297497 CTGGAAAAGGATGAATCCAGAGG - Intronic
1079901933 11:26197812-26197834 GTGGATGAGGATTAAAACAGAGG - Intergenic
1083819292 11:65158074-65158096 GTGGAAGAAGAAGAAACCAGAGG - Intergenic
1086366669 11:86113978-86114000 TTGGATGAGGATGATATCAGTGG - Intergenic
1086412048 11:86553022-86553044 CTGGAAGAGGTGAAAGCCAGAGG - Intronic
1086529944 11:87773130-87773152 CTGAAAGAGGAAGAAACCACTGG - Intergenic
1087578581 11:100023442-100023464 CTGGTAGATGATGATAACAGAGG - Intronic
1089059315 11:115613313-115613335 CTGGAACAGAATAAAAACAGAGG - Intergenic
1089283083 11:117388058-117388080 CTGGAAGAGGAGGATGCTAGGGG - Intronic
1090265337 11:125349983-125350005 CTGGAAGAGGATGAAGCCCTAGG + Intronic
1091696683 12:2632661-2632683 CTAGAAGGGGATGAAGACAGTGG - Intronic
1091760089 12:3081437-3081459 GTGGAAGAGGATGAACTAAGGGG - Intronic
1091936344 12:4437396-4437418 ATGGAAGAGCAGGAAGCCAGAGG + Intronic
1092262253 12:6959051-6959073 GGGGAAGAGGAGGAAGCCAGAGG - Intronic
1092477378 12:8830672-8830694 ACGGAAGAGGAAGAAAGCAGGGG - Intronic
1094084373 12:26573672-26573694 CAGGAAGAGGATCCAAACAGAGG + Intronic
1094118766 12:26946535-26946557 CTGGCAGATCATGAAGCCAGGGG - Intronic
1095242890 12:39881761-39881783 GTGGGAGAGGATGAAAAGAGGGG + Intronic
1096319373 12:50598430-50598452 GAGGAAGAGGATGGAATCAGGGG - Intronic
1096539338 12:52296241-52296263 CAGGAAGAGGAGGAAACTGGAGG + Intronic
1096543429 12:52321371-52321393 ATGGCAGAGGATGGAACCAAGGG + Exonic
1096673060 12:53211501-53211523 CAGGAAGGGGATGAACACAGAGG + Exonic
1097521626 12:60678066-60678088 CAGGAAGATGAAGAAAACAGAGG - Intergenic
1098257681 12:68633947-68633969 CGGGAAGAGGAGGATACAAGAGG - Intronic
1100731872 12:97479705-97479727 CGGGCTGAGGATGAACCCAGGGG - Intergenic
1101013508 12:100475519-100475541 CTTGAAGAGGTGGAAACAAGAGG - Intronic
1102016777 12:109653285-109653307 CTGGAGGAGCAGGAAATCAGGGG + Intergenic
1103318144 12:120073659-120073681 CTGTAGGAGGATGAAACGTGAGG - Intronic
1103894879 12:124266423-124266445 CTGTAAGAGGATGGACACAGAGG - Intronic
1106195621 13:27491717-27491739 CAGGAAGAGGAAGAAACAGGAGG + Intergenic
1106630884 13:31471580-31471602 CTGTGAAATGATGAAACCAGGGG + Intergenic
1107720531 13:43243642-43243664 CTGGAAGAGGAAGAGCCTAGAGG - Intronic
1109313665 13:60724748-60724770 CTGGAATAGGGTAAAATCAGTGG + Intergenic
1112904236 13:104397442-104397464 CTGTGGGAGGCTGAAACCAGAGG + Intergenic
1114490432 14:23097662-23097684 ATTGAAGAGGATGACTCCAGTGG - Exonic
1115719067 14:36139764-36139786 ATGCAAGACGCTGAAACCAGGGG - Intergenic
1117475004 14:56085094-56085116 CTGGCAGAGGAGCAATCCAGAGG - Intergenic
1117954456 14:61111774-61111796 CTGGAAGAATATAAAACCTGGGG + Intergenic
1118319787 14:64746495-64746517 CCAGAGGAGGATGAAGCCAGCGG - Exonic
1118726216 14:68630782-68630804 CTGGGAGAGCTTGAAACCAGGGG - Intronic
1118957525 14:70496902-70496924 AGGAAAGAGGATGAATCCAGGGG + Intergenic
1120073838 14:80133793-80133815 CAGGAAGGGAATAAAACCAGAGG - Intergenic
1125010644 15:34869744-34869766 CTGGAAGAAAATAAAATCAGAGG - Intronic
1125037437 15:35142344-35142366 CTGGCAGAGAAGGAAGCCAGAGG + Intergenic
1125405147 15:39344990-39345012 AAGGAACAGGATGATACCAGGGG + Intergenic
1125760698 15:42093866-42093888 CTGGCAGAGGATGAAAACTCTGG + Intronic
1127737616 15:61858908-61858930 CTGGAAGAGAATCAGTCCAGAGG - Intronic
1128509261 15:68303405-68303427 CAGGAGGAGGCTGAGACCAGGGG + Intronic
1128721519 15:69954124-69954146 CTGGAAGAGGTTGACTTCAGGGG - Intergenic
1129896991 15:79115765-79115787 CAGGAAGAGGTTGAACCCACGGG - Intergenic
1131172994 15:90191647-90191669 CTGGAAGTGGTAGAATCCAGTGG - Intronic
1131262390 15:90894083-90894105 CTGGAAGAGGGTGCAGCCTGAGG - Intronic
1131277920 15:90997739-90997761 CTGGAAGTGGATGACAACAAAGG + Intergenic
1132012415 15:98287743-98287765 CTGGAAGTTGCTGCAACCAGAGG + Intergenic
1133393176 16:5425755-5425777 CTGGAAGAGGTGGGAACCTGAGG - Intergenic
1134189760 16:12112015-12112037 CTGGCAGAGGATGCACACAGAGG + Intronic
1134628033 16:15736922-15736944 CAGGAAGAGGGAAAAACCAGAGG + Intronic
1134628720 16:15741509-15741531 CTGGAGGAGGAGGAAGACAGGGG - Exonic
1135206595 16:20490220-20490242 CTGGAGGGTGATGAAGCCAGAGG - Intergenic
1135212291 16:20533412-20533434 CTGGAGGGTGATGAAGCCAGAGG + Intergenic
1136069227 16:27778121-27778143 ACTGAAGAGGATGGAACCAGGGG + Intronic
1137301065 16:47147902-47147924 TTAGAAGAGGAAGAGACCAGGGG - Intergenic
1138093679 16:54195840-54195862 CAGGGAGATGATGAATCCAGGGG + Intergenic
1138273031 16:55709829-55709851 CTGGAAAGGGAGGAGACCAGAGG + Intergenic
1139563404 16:67757939-67757961 CAGGTAGATGATGATACCAGGGG + Intronic
1139798643 16:69503336-69503358 CAGGAAGAGGTGGATACCAGGGG - Intergenic
1141652024 16:85397831-85397853 CTGGAGGAGGAGGATCCCAGGGG - Intergenic
1141998160 16:87648050-87648072 CTGGGGGAGGATGACACCAATGG - Intronic
1143603085 17:7962232-7962254 CTAGAAGAGGAGGACACTAGTGG + Intergenic
1146908902 17:36635396-36635418 CTGGCAGAGGAGGGAAGCAGAGG + Intergenic
1147028823 17:37613346-37613368 CTGTAAGAGAATGAAGACAGAGG + Exonic
1147153861 17:38533542-38533564 CTGCAAAAGGAAGAAGCCAGAGG + Intronic
1147515903 17:41117518-41117540 CTGGAAGAGAAAGAAAGCAAGGG + Exonic
1147743783 17:42683102-42683124 TGGGAAGAGGATGAAGTCAGCGG + Intronic
1147993809 17:44350668-44350690 CTGGAAGAGGAGCAAACGTGAGG - Intronic
1148647306 17:49226405-49226427 CTGGATGTTGATGAGACCAGAGG - Intronic
1151126456 17:71850567-71850589 CTAGGCCAGGATGAAACCAGTGG - Intergenic
1151416031 17:73965450-73965472 CTGGAAGTGGAAGAAACTGGTGG - Intergenic
1151620644 17:75242912-75242934 CTGAGAGAGGAGGAAATCAGAGG + Intronic
1152635828 17:81430140-81430162 GTGGATGAGGATGAGAGCAGGGG + Intronic
1153288784 18:3480448-3480470 CTGGAAGAGGATGTACAAAGAGG - Intergenic
1153503346 18:5770657-5770679 CTCAAAGGGGATGAAATCAGAGG - Intergenic
1153537758 18:6120610-6120632 CTGGAAGAGGAGGAATGGAGGGG - Intronic
1153966395 18:10186620-10186642 CTGGAAGAGGGGGTAACAAGGGG - Intergenic
1153977339 18:10281073-10281095 CTGAAAGAAGGGGAAACCAGAGG - Intergenic
1155197960 18:23492770-23492792 CTGGAAGAGGCTGGACACAGTGG + Intergenic
1155322723 18:24634186-24634208 CTGGGCAAGGATGAAACCATGGG + Intergenic
1155324682 18:24653861-24653883 GTGGAAGTGGATGCAACCACTGG - Intergenic
1155900506 18:31383206-31383228 CTGAAACAGGAAGAAGCCAGGGG + Intronic
1156453481 18:37279799-37279821 CTGGAAAAGCATGAAACCCTTGG - Intronic
1156668463 18:39437426-39437448 CTGCAATTGGATGAAACAAGTGG - Intergenic
1156866617 18:41895744-41895766 TTGGATGAGGATGAAATCATAGG - Intergenic
1157133709 18:45033572-45033594 GTGGAAGAGGCTGACACCACTGG - Intronic
1157911702 18:51622873-51622895 CTGGAGGAGGGGGAAGCCAGAGG - Intergenic
1157975310 18:52320161-52320183 CAGGAAGAGGATGAAAAGAGAGG - Intergenic
1158082954 18:53615794-53615816 GAGGAAGAGGAAGAAACCATAGG - Intergenic
1158619251 18:59016796-59016818 CTAGAAGAGGAAGAAAGAAGTGG + Intergenic
1160017539 18:75155999-75156021 CGGCAGGAGGATGTAACCAGAGG + Intergenic
1163664554 19:18597146-18597168 AGGGAAGAGGAGGAAAACAGAGG - Intronic
1163866094 19:19774707-19774729 AAGGAGGAGGATGAAAACAGAGG + Intergenic
1164039651 19:21483564-21483586 TGGGAAGAGGAGGAAACCAGAGG - Intronic
1166042974 19:40214257-40214279 CTGGCAGAGGAGGAAAGAAGGGG - Intronic
1166206386 19:41272344-41272366 CAGGAAGAGTGTGAAAGCAGAGG - Intronic
1167109959 19:47454381-47454403 CTGGGAGAGGATGGACCGAGTGG + Intronic
1168582941 19:57570404-57570426 GTGCAAGAGGATGGAATCAGAGG + Intergenic
925128190 2:1476730-1476752 CTGGAAGAGGTTGAACCCAGAGG - Intronic
925158691 2:1666215-1666237 CTGGACGATGATGAAAGCGGTGG + Exonic
925222519 2:2153524-2153546 CGGGAAGAGGAGGAAGGCAGAGG + Intronic
926141316 2:10370212-10370234 TTGGAAGAAGATAAAAGCAGAGG - Intronic
927045107 2:19270284-19270306 CTGGAAGAGAATAAAATGAGTGG + Intergenic
927684966 2:25164164-25164186 CTGGAAGAAGGAAAAACCAGGGG - Intronic
929383176 2:41377607-41377629 CCTTAAAAGGATGAAACCAGAGG - Intergenic
930409944 2:51012909-51012931 CTGGAGGAGGATGAGATTAGAGG - Intronic
930634662 2:53790714-53790736 CTTTAAGAGGCTGAGACCAGAGG - Intronic
932948130 2:76261629-76261651 CTGGGAGAGGCTGAAACCAAGGG - Intergenic
934719513 2:96563876-96563898 AAGGAAGGGGATGAAACAAGGGG - Intergenic
935044546 2:99468419-99468441 TTGGAACAGGATAAAAACAGAGG - Intronic
935109646 2:100080812-100080834 CAGGAAAAGGTTGGAACCAGAGG + Intronic
935287594 2:101579214-101579236 CTGGAAGAGGCCAAAACAAGAGG + Intergenic
936125328 2:109784397-109784419 CAGGAAAAGGTTGGAACCAGAGG - Intergenic
936219365 2:110587071-110587093 CAGGAAAAGGTTGGAACCAGAGG + Intergenic
937358682 2:121214082-121214104 CTGAAGGAGGATGATGCCAGGGG - Intergenic
939042605 2:137208692-137208714 CTGGTTGTGGATGAAATCAGAGG + Intronic
939523581 2:143263446-143263468 CTGGAAGATCATGTAATCAGTGG + Intronic
940423037 2:153500709-153500731 TTAGAAGAGGATCAAACAAGAGG + Intergenic
941673394 2:168318917-168318939 CTGGAATTGAATGAAACCACAGG - Intergenic
942046621 2:172102732-172102754 CCGAAAGAGGATGCGACCAGAGG - Exonic
942901457 2:181124792-181124814 GTGGAAGAAGATGAAACCAGAGG + Intergenic
943699306 2:190972493-190972515 CTGAAAGAGGGTGGTACCAGGGG - Intronic
948973677 2:241449049-241449071 CTGGAAGAGGATGTCATGAGTGG - Intronic
1170031329 20:11947301-11947323 CTGGAGGAGGATGACATTAGAGG + Intergenic
1170728144 20:18948162-18948184 CTGGGAGAGGGTGAGGCCAGAGG + Intergenic
1171490064 20:25510521-25510543 CTGCAGGAGGAAGAATCCAGCGG + Intronic
1173672202 20:44806395-44806417 CAGGAAGAGCAGGGAACCAGTGG + Intronic
1173835977 20:46126031-46126053 CTGGAAGAACCTTAAACCAGAGG + Intronic
1174537003 20:51258912-51258934 CTGTCAGAGAATGAAACCTGCGG + Intergenic
1175366364 20:58459000-58459022 GTGAAAGAGAATAAAACCAGTGG - Intergenic
1175562515 20:59942250-59942272 CTGGAAGATGATGACAGCTGGGG - Exonic
1178242583 21:30919667-30919689 CTGGAAGAGGAGAATACCTGGGG - Intergenic
1178254635 21:31041056-31041078 CTGGGTCAGGATGAAATCAGCGG - Intergenic
1178797455 21:35757953-35757975 CAGGATGAGGATGAAGCCACAGG + Intronic
1179664763 21:42903463-42903485 CTGGAAGAGGATGAAGACGAAGG - Exonic
1181382280 22:22515655-22515677 CTGGAAGTTGAAGAGACCAGTGG - Exonic
1183088686 22:35506014-35506036 CTGGAAAAGGACAAAACCATAGG - Intergenic
1183115781 22:35691625-35691647 CAGGGAGAGGATGATACTAGTGG - Intergenic
1183210631 22:36449256-36449278 CAGGAGGAGGATGAAACCTGTGG - Intergenic
1183382834 22:37498938-37498960 CAGGGAGAGGTGGAAACCAGAGG + Intronic
1184271355 22:43386083-43386105 CTGGAAAATGATGGAAGCAGGGG + Intergenic
1184388741 22:44190940-44190962 CTGGCAGAGGCTGAGGCCAGGGG + Intronic
953017974 3:39096737-39096759 CAGGGAGAACATGAAACCAGAGG - Exonic
953183808 3:40620083-40620105 CTTGGAGAGGATGAAACTGGTGG + Intergenic
955370325 3:58345877-58345899 CTGGAAGAGGATGAACAACGAGG - Intronic
958827623 3:99050761-99050783 CTTGAGAAGGATGAAACCACAGG + Intergenic
959011792 3:101086037-101086059 TTGGAAGAGCATGTAAGCAGTGG - Intergenic
959426890 3:106201404-106201426 CTGGAACAGGAGGAAGACAGTGG - Intergenic
962388516 3:134952634-134952656 CTGGAAGGAGATGAAACTATTGG + Intronic
964544838 3:157822497-157822519 GAAGAAGAGGATGAAATCAGAGG - Intergenic
964718236 3:159745269-159745291 CTGGAAGAGGTTCAAAGAAGTGG - Intronic
964979700 3:162664667-162664689 TTGGATGAGGATGAAATCACAGG + Intergenic
965427595 3:168546551-168546573 CTGGATAAAGATAAAACCAGGGG - Intergenic
965590097 3:170354924-170354946 ATGGAAGAAGATGAAACAATAGG + Intergenic
967407222 3:189130593-189130615 CTGTAATAGGATGAAACTAGAGG + Intronic
967965793 3:194959375-194959397 CTGGGAGAGAACGAGACCAGAGG + Intergenic
968033460 3:195524276-195524298 CTTTAGGAGGCTGAAACCAGCGG + Intronic
968097344 3:195941077-195941099 CTGGAATAGTTTGAACCCAGTGG - Intergenic
968347501 3:198022745-198022767 ATGGAGGAGGACGAAGCCAGAGG + Intronic
968390513 4:188518-188540 CAGGAAGAGGCTGAATCCAGGGG - Intergenic
968494720 4:909267-909289 CTGGGAGGTGCTGAAACCAGTGG - Intronic
969282616 4:6181302-6181324 CTGAGAGAGGAAGAGACCAGGGG + Intronic
969430571 4:7151498-7151520 CCGGCAGATGATGAAACCACAGG + Intergenic
970158046 4:13161214-13161236 GTGGAAGAGAATGAAAACACCGG + Intergenic
970429058 4:15971955-15971977 CTGGAAAAGGGTGCAAGCAGGGG + Intronic
971744507 4:30561862-30561884 CTGGAGGAAGCTGAAAACAGAGG - Intergenic
972880258 4:43414220-43414242 CGGCAACAGGATGGAACCAGAGG + Intergenic
972966835 4:44520579-44520601 TTGGAATGGGATGAGACCAGAGG + Intergenic
973133541 4:46677603-46677625 CTGGCAGAGGATAATGCCAGTGG - Intergenic
974062827 4:57051172-57051194 GGGGAAGGGGATGAAACAAGTGG + Intronic
975117737 4:70697860-70697882 CTGGAATAGATTAAAACCAGAGG + Intergenic
975356171 4:73407256-73407278 CTGGGGGAGGACGAAACGAGGGG - Intronic
976084336 4:81392067-81392089 CTGTAAGAGGCTGGAACCAAAGG - Intergenic
976537630 4:86236824-86236846 CAGGAAAAGGAGGAAACTAGAGG + Intronic
976882075 4:89939063-89939085 ATGAAAGATGATGAAACCAGTGG + Intronic
976895100 4:90099902-90099924 TTGGTTGAGGATGAAACCATAGG + Intergenic
978279157 4:106988858-106988880 CTGAAAAAGGATGAAAACAGAGG - Intronic
979491907 4:121337894-121337916 ATGGAAGAGGACGGAACCAAGGG + Intronic
981032304 4:140137461-140137483 CTGTAAGAGGAAGAAGCAAGAGG - Intronic
982085469 4:151831180-151831202 CTGCATGAGAATGAAGCCAGAGG + Intergenic
983561781 4:169108874-169108896 CTGGAAGAGGATGAAACCAGTGG + Intronic
984716758 4:182933274-182933296 CAGGAAGAGGCTGAAGCTAGAGG - Intergenic
988998578 5:36738088-36738110 CAGGAAGAGGATGAAGGTAGTGG - Intergenic
990328904 5:54706025-54706047 CTGGAAGAGGAGAAAACAGGAGG - Intergenic
990473462 5:56139564-56139586 ATGGAAGAGCATGACAGCAGGGG + Intronic
990618069 5:57528275-57528297 TTGGAAGAGGATTAGAACAGGGG + Intergenic
990833534 5:59987693-59987715 AGGAAAGAGGATGAAGCCAGTGG - Intronic
991315609 5:65301617-65301639 TAGGAAGAGAATGGAACCAGGGG + Intronic
994153177 5:96473496-96473518 CTGGAGGAGAAAGAAATCAGGGG - Intergenic
994897147 5:105721193-105721215 AGGGAAGAGGCTGAATCCAGGGG + Intergenic
995476202 5:112551027-112551049 CTGGATGAGGGTGGCACCAGGGG - Intergenic
998064909 5:139150313-139150335 CTGGAGGAGGATGAGACGTGTGG - Intronic
998223791 5:140310109-140310131 CTGGATGAGGATGATAGCAGTGG + Intergenic
998305993 5:141077739-141077761 CTGAAAGAGGATGAAAAGAAGGG - Intergenic
998733795 5:145111507-145111529 CTGGAAGGGGAAGACACTAGGGG + Intergenic
999125385 5:149242326-149242348 TTGGAAGAGGAAGTCACCAGGGG + Intronic
999844029 5:155458898-155458920 CTTGAAGAGGATGAAATTAGAGG + Intergenic
1000759632 5:165206383-165206405 CTGGAAGAGAATGAAAGGATGGG + Intergenic
1001043593 5:168354390-168354412 CTGGAATAGAATTAAATCAGGGG + Intronic
1001407613 5:171487008-171487030 CTCGAAGAGGATGGAAGCACAGG + Intergenic
1001687425 5:173604686-173604708 CTAGCAGAGGGTGAAGCCAGAGG + Intergenic
1002169120 5:177365720-177365742 CTGGGGGAGGAGGGAACCAGGGG + Intronic
1003459130 6:6313906-6313928 CTAGAAGAGGAATAGACCAGAGG - Intronic
1003893561 6:10585424-10585446 CAGGAAGAGAAAGAAACCAGAGG + Intronic
1006941435 6:37754259-37754281 CTGGCAGTGGATTAGACCAGCGG + Intergenic
1007419488 6:41711289-41711311 GTGGGAGAGGAGGAAACCAAGGG - Intronic
1007942848 6:45798514-45798536 TTGGCAGGGAATGAAACCAGAGG - Intergenic
1008505142 6:52222935-52222957 CTGGAAGAGAATGAAAAAATTGG - Intergenic
1010006812 6:71004279-71004301 CTGGAAGAACATGAATTCAGAGG + Intergenic
1015165878 6:130199428-130199450 ATAGAAGAGGAAGAAGCCAGGGG + Intronic
1015732795 6:136365411-136365433 CTGGCAGAGGTGAAAACCAGTGG + Intronic
1016074246 6:139777407-139777429 CTGCAAGAGCCTGAAACCAGGGG - Intergenic
1016888924 6:148986216-148986238 CTGGAAGAGTAAGTAACCAATGG - Intronic
1018804569 6:167248877-167248899 AAGGAAGAGGAAGAAAACAGGGG - Intergenic
1019312147 7:368085-368107 CTGGAAGACGAGCACACCAGGGG - Intergenic
1021913668 7:25410591-25410613 CTGGAGGAAAATGTAACCAGAGG + Intergenic
1023521011 7:41050012-41050034 TGGGAGGAGAATGAAACCAGAGG + Intergenic
1026540908 7:71279232-71279254 CTAGATTAGGATGAATCCAGTGG - Intronic
1027339752 7:77193050-77193072 CTGGAATAGACTGAAACCAGAGG + Intronic
1028675107 7:93450605-93450627 CTGGAAAGGGATAAAACCAAGGG + Intronic
1028986653 7:97014874-97014896 CTGAAAGAGAATGAAGACAGAGG - Intergenic
1029272200 7:99384028-99384050 CTGGAAGTGGAGGAGCCCAGTGG - Intronic
1030190914 7:106809210-106809232 CAGGTAGATGAGGAAACCAGTGG + Intergenic
1030542519 7:110849123-110849145 CTGGTAGAGGATGTAAACAGTGG + Intronic
1031452057 7:121934094-121934116 CTAGATGTGGATGAAACCATAGG + Intronic
1032791274 7:135244453-135244475 CTTGAAGAGAATGAAACAATAGG - Intronic
1033323216 7:140358786-140358808 CTTGAAGAGGAGGAAACAAAAGG + Intronic
1034190959 7:149213302-149213324 ATGGCAGAGGCTGCAACCAGAGG - Intronic
1034450900 7:151136787-151136809 CTGGAAGGGAATGAAAGCAGGGG + Intronic
1034682598 7:152940436-152940458 CAGGAAGAGGATGTGACAAGGGG + Intergenic
1035274562 7:157739918-157739940 CTGGAAGAGGAAGAGGTCAGAGG - Intronic
1035855359 8:2969685-2969707 ATGAAAAAGGATGTAACCAGTGG - Intronic
1035988939 8:4466273-4466295 CTTGATGAGGAAGAAAACAGAGG + Intronic
1036420402 8:8590271-8590293 ATGGAAGAAGAGGAAACCAACGG + Intergenic
1041139013 8:54794617-54794639 CTAGAAGAGAAAGAAACCATAGG + Intergenic
1041542610 8:59003062-59003084 TTAGAAGAAGATGAAACCAAAGG - Intronic
1042988817 8:74615402-74615424 CTTGAAGATGAGGAAAACAGAGG + Intronic
1042990886 8:74638457-74638479 CTTGAAGGGGATGAAACTAGAGG + Intronic
1043640470 8:82443613-82443635 CTGGAAGAGCATGATACTTGGGG + Intergenic
1046503553 8:115109951-115109973 CAGGAAGGGGATGATACCACTGG + Intergenic
1047089721 8:121560319-121560341 TTGGAAGAGGGTGAAGGCAGTGG - Intergenic
1047170935 8:122491599-122491621 CTGGAAGAGTAGGACAACAGAGG - Intergenic
1047295705 8:123568923-123568945 CAGGAAGAGGAGGACCCCAGAGG - Intergenic
1047323887 8:123818111-123818133 CTGGCAGAGTCTGAAACAAGAGG + Intergenic
1048618048 8:136100887-136100909 CTGGGAAAGGATGAAAGCAATGG - Intergenic
1049440888 8:142609241-142609263 CTGGGAGAGCAGGAAACAAGAGG - Intergenic
1049666870 8:143848730-143848752 CTGGAAGAGGATGCATCATGTGG - Intergenic
1049736541 8:144210037-144210059 CTGGAATAGGATGCAAGGAGGGG - Intronic
1051254027 9:15193212-15193234 CTGGAGCAGGAAGAAAGCAGAGG - Intronic
1051290746 9:15543213-15543235 GTGGAAGATGCTGAAAACAGGGG - Intergenic
1053042605 9:34887435-34887457 GTGGTAGAGGATGACTCCAGTGG - Intergenic
1053738232 9:41115501-41115523 GAGGGAGAGGATGATACCAGTGG + Intergenic
1054690120 9:68315817-68315839 GAGGGAGAGGATGATACCAGTGG - Intergenic
1055254097 9:74345448-74345470 CTGATAGAGGATCAAACAAGAGG + Intergenic
1056087311 9:83163119-83163141 GTGGAATAGGATGGAAACAGTGG - Intergenic
1056418078 9:86396797-86396819 CTGGGAAAGGATCAACCCAGAGG + Intergenic
1057178683 9:93017568-93017590 ATGGAAGAGGATGGAATCTGTGG + Intronic
1057209021 9:93189566-93189588 CTGGGAGTGGATGATGCCAGAGG + Intronic
1057390075 9:94635496-94635518 CTAGAAGAGCATGTACCCAGAGG - Intronic
1057471955 9:95365950-95365972 CTGGAAGAGGCTAAAACATGTGG - Intergenic
1057917095 9:99065346-99065368 TTGGAAGATGATGAGACCATAGG + Intronic
1058503750 9:105648215-105648237 CTGGATGAGGGAGAAGCCAGAGG - Intergenic
1058715344 9:107717706-107717728 CTGGAAGTAGAGAAAACCAGAGG + Intergenic
1059517227 9:114907306-114907328 ATGCATGAGGATGAAACCAAGGG - Intronic
1060512289 9:124242873-124242895 CTGGAGGAGTATGAAGGCAGCGG - Intergenic
1060729593 9:126028973-126028995 CAGGAAGAGGATGGAACCCGTGG - Intergenic
1062468906 9:136693653-136693675 CTGGGTGAGGAGGGAACCAGAGG + Intergenic
1062649996 9:137570685-137570707 ATAGAAGAGGGTGAAATCAGAGG - Intronic
1203771569 EBV:52430-52452 CTGGAAGAAGATGAAGCCGGTGG + Intergenic
1186616585 X:11194884-11194906 ATGGAAGGCGATGAAACCAAGGG - Intronic
1187393868 X:18903668-18903690 CTGGAGGTGGAGGCAACCAGAGG + Intronic
1189153769 X:38734111-38734133 CTGGAAGAAAATGAACCCCGAGG + Intergenic
1189704802 X:43749290-43749312 GAGGAAGAGGATGAAAACAAAGG + Intergenic
1191689456 X:63925057-63925079 CTGGAAGAGGATAAGAAAAGTGG + Intergenic
1192000932 X:67150579-67150601 CTGGAAGACGTGGAGACCAGAGG - Intergenic
1192313352 X:70034090-70034112 CAGGAAGAGGACAAAAGCAGAGG - Intronic
1192364438 X:70459332-70459354 CTGGAAGAGTTAGAAATCAGTGG + Intronic
1193794241 X:85853567-85853589 CTGAAAGAGAATGATAACAGTGG + Intergenic
1194756118 X:97741830-97741852 CTGGGAGTGGATGAATACAGGGG + Intergenic
1195104912 X:101594143-101594165 AGGAAAGAGGCTGAAACCAGGGG - Intergenic
1195912681 X:109904434-109904456 CTGGAAGAGAAAGATAGCAGAGG - Intergenic
1196781790 X:119390126-119390148 ATGGGAGAGGATGATACAAGCGG - Intergenic
1196824247 X:119728478-119728500 GGGGAAGAGGGAGAAACCAGTGG + Intergenic
1197273886 X:124455370-124455392 TTGGATGAGGATGAACCAAGGGG + Intronic
1198439214 X:136645740-136645762 CTGGAATAGGATGATGGCAGGGG + Intergenic
1199385319 X:147216679-147216701 CTAGAACAGGAGGAAAACAGAGG - Intergenic