ID: 983561782

View in Genome Browser
Species Human (GRCh38)
Location 4:169108878-169108900
Sequence AAGAGGATGAAACCAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561776_983561782 16 Left 983561776 4:169108839-169108861 CCTACACCTACTAAAGCTTAGAG 0: 1
1: 1
2: 1
3: 4
4: 99
Right 983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 316
983561778_983561782 10 Left 983561778 4:169108845-169108867 CCTACTAAAGCTTAGAGGCTGAG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 316
983561774_983561782 29 Left 983561774 4:169108826-169108848 CCTAGTGCAGGGCCCTACACCTA 0: 1
1: 0
2: 0
3: 16
4: 361
Right 983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 316
983561775_983561782 17 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG 0: 1
1: 0
2: 0
3: 32
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561782 Original CRISPR AAGAGGATGAAACCAGTGGA AGG Intronic
900526517 1:3131854-3131876 AGGAGGAGGAAGGCAGTGGAGGG - Intronic
900881266 1:5382960-5382982 AAGATGATGACACCACAGGAGGG + Intergenic
904552436 1:31330760-31330782 AAGAGGATTAAATGAATGGATGG + Intronic
904825012 1:33268673-33268695 GAGAGGATGCAGCCTGTGGAAGG + Intronic
905221684 1:36452172-36452194 AAGAGTAGGAAACCACTGAAGGG - Intergenic
905934865 1:41815365-41815387 AGGAGGCTGAAACAAGAGGATGG + Intronic
907093509 1:51752406-51752428 AAGAAAAAGAAACCAGTGGGAGG - Intronic
907956254 1:59230986-59231008 AAGGGTAGGATACCAGTGGAAGG - Intergenic
909525819 1:76621331-76621353 AAGAGAATGAACCAAGTGAAAGG - Intronic
909654981 1:78021601-78021623 AAGAAGAGGAAACCAGAGGTTGG + Intronic
909786430 1:79619929-79619951 AAGATGATGGTTCCAGTGGAAGG - Intergenic
911183599 1:94882328-94882350 AAGAGGAGGAAACCAGGGAGTGG + Intronic
911189759 1:94936175-94936197 GAAAGAAAGAAACCAGTGGAAGG + Intergenic
912724101 1:112043666-112043688 AAGAGCATGATCCCAGTGAAAGG + Intergenic
913234832 1:116770825-116770847 AAGTGCATGAACCCAGAGGAAGG + Intergenic
913359796 1:117967606-117967628 AAAATAATGAAACCAGTAGAGGG + Intronic
914346095 1:146799601-146799623 GAGAGGAAGGAACCAGTGGTGGG - Intergenic
914427833 1:147594956-147594978 AAGAGTAAGAAGCCAATGGATGG + Intronic
915770290 1:158415142-158415164 GAGAGGATGAAATCAATGCACGG + Intergenic
916452108 1:164930571-164930593 AAAATGATGTACCCAGTGGAGGG - Intergenic
916456241 1:164973563-164973585 ATGAGAATGAACACAGTGGAGGG + Intergenic
917085831 1:171305379-171305401 AAGACCATGAACCCACTGGAAGG + Intergenic
918464534 1:184807905-184807927 TGGAAGATGAAGCCAGTGGAGGG + Intronic
918489497 1:185065763-185065785 GAGAGCAAGAAACCACTGGAAGG + Intronic
918939905 1:190980073-190980095 AAGACCATGAACCCACTGGAAGG - Intergenic
920098333 1:203500532-203500554 AAAAGGATGAAAACAGTGGGTGG - Intronic
920871432 1:209798350-209798372 CAGAGGATCAAACAAATGGAAGG - Intronic
922353234 1:224752540-224752562 GAGAGGTGGAAACCAGTGAAGGG - Intergenic
923388791 1:233492933-233492955 AAGAGATTGAAACCAATGAAAGG - Intergenic
923568347 1:235093245-235093267 ATGAGGAGGAAACAAGGGGAAGG - Intergenic
923889024 1:238190529-238190551 AAGAGGAAGAAACACTTGGAAGG + Intergenic
924191776 1:241561043-241561065 AACAGGAGGAGAGCAGTGGAGGG - Intronic
924445762 1:244128778-244128800 AGGAGGAAGCTACCAGTGGAGGG + Intergenic
924606436 1:245539606-245539628 AAGAAGAAGAAAACAGGGGAAGG - Intronic
924680372 1:246224975-246224997 GTGAGGATGAAACCAGTAGATGG + Intronic
1064124891 10:12651113-12651135 AGGACGCTGAAAACAGTGGAGGG - Intronic
1064305777 10:14164629-14164651 AAGAAGATGGAGCCAGTGAATGG + Intronic
1067064017 10:43093603-43093625 CAGAGGAGGAAACCAGCCGAGGG + Intronic
1068240293 10:54295688-54295710 AAGACCAAGAACCCAGTGGAAGG + Intronic
1070842417 10:79496417-79496439 AAGAAGATGCAACCAGTGAGGGG + Intergenic
1071061813 10:81578933-81578955 GAGACCATGAAACCACTGGAAGG + Intergenic
1076988627 11:257399-257421 AAGAGGTTGAAGGCTGTGGACGG - Intergenic
1077705378 11:4480368-4480390 ATGAGGATGAAAGCAGAGAAAGG - Intergenic
1078210825 11:9267930-9267952 AAGGGAATGAAACCAGGGCAGGG + Intergenic
1078929393 11:15901524-15901546 AAGAGGATGAGGACAGGGGATGG + Intergenic
1078953508 11:16163094-16163116 AAGAGTATGAAAAAAGAGGAGGG + Intronic
1079934531 11:26600489-26600511 AAGAGGATGAGAGGAGGGGAGGG - Intronic
1081025243 11:38004671-38004693 AAGATCATGAACCCACTGGAAGG + Intergenic
1081085628 11:38796754-38796776 CATAGGAGGAAACCAGTGGGAGG + Intergenic
1081447610 11:43145722-43145744 GAGAGGATGAAGCCAGTGCATGG + Intergenic
1084101213 11:66950948-66950970 AAGGGGGTGAAACTCGTGGAGGG + Intronic
1084744065 11:71156419-71156441 GAGACGGTGACACCAGTGGAGGG - Intronic
1085757614 11:79214761-79214783 CAGAGGAGGAAATCACTGGAAGG - Intronic
1085896556 11:80647006-80647028 AAGAGGAAGAAAGTTGTGGAAGG - Intergenic
1086290711 11:85306188-85306210 ATGAGGCTGAAACCAGGAGAAGG - Intronic
1087088707 11:94245987-94246009 AAGAAAATGAAACCAGGGCAAGG + Intergenic
1087397909 11:97625886-97625908 AAGGTGATGAGACCTGTGGATGG - Intergenic
1087768246 11:102179511-102179533 AAGAGGCTGCTACCTGTGGATGG - Intronic
1088214982 11:107497909-107497931 AAGACCATAAAACCACTGGAAGG + Intergenic
1089774647 11:120827781-120827803 GAGGGAATTAAACCAGTGGATGG - Intronic
1090649918 11:128797527-128797549 AAGAAGAGAAAACCAGAGGAGGG - Intronic
1091936345 12:4437400-4437422 AAGAGCAGGAAGCCAGAGGAAGG + Intronic
1093449270 12:19296909-19296931 AAGAGTAAGAAACAAATGGAAGG - Intronic
1093852865 12:24062052-24062074 AAGATGATGATACCATTTGATGG - Intergenic
1095253980 12:40011870-40011892 AAGAGGATTAAACCAAGGGCAGG + Intronic
1096156992 12:49346430-49346452 AAGCTGAAGAAACGAGTGGAGGG - Intergenic
1096299529 12:50414406-50414428 AAGAGGCTGAGACGAGAGGATGG - Intronic
1097229060 12:57498124-57498146 AAGAGGAAGAGAACAGTGCATGG - Intronic
1097959349 12:65517321-65517343 TAGAGGAAGCATCCAGTGGAAGG + Intergenic
1098090258 12:66893842-66893864 AAGATGCTGAAACCATTGGAGGG - Intergenic
1098181534 12:67852395-67852417 AAAGGGATGAGGCCAGTGGAGGG + Intergenic
1099428809 12:82555862-82555884 AAGAGAATGAAATCAGTCCAAGG - Intergenic
1099544222 12:83956133-83956155 CAGAGGAGGGACCCAGTGGAAGG - Intergenic
1101013507 12:100475515-100475537 AAGAGGTGGAAACAAGAGGAAGG - Intronic
1101309614 12:103564286-103564308 AAGGGGATGACACCAGTGTCTGG + Intergenic
1103257233 12:119552335-119552357 AAGAGCATGAAACAAATGCAAGG + Intergenic
1104625522 12:130351017-130351039 AAGAGGCTGAAAACAGTGGGAGG - Intronic
1105604344 13:21914429-21914451 CAGAGGATGGAAACAGGGGAAGG - Intergenic
1106457774 13:29942462-29942484 CAGAGGTTGAAACCAATGAAAGG + Intergenic
1106810455 13:33353449-33353471 AAAAGGAGGAACCCAGGGGAGGG - Intergenic
1107610418 13:42107403-42107425 GTGAAGATGAAACCAGTGGGAGG + Intronic
1109226374 13:59700653-59700675 CAGAGGATAAAGCCAGTTGATGG + Intronic
1109716007 13:66223223-66223245 AAGAGAAAGAAGCCAATGGAAGG - Intergenic
1110402310 13:75107182-75107204 AAGAGCATGGTATCAGTGGAGGG + Intergenic
1111225728 13:85267847-85267869 AATAGAATTAAACAAGTGGAAGG + Intergenic
1112760261 13:102687370-102687392 AACATGATTAAACCAGTGGAAGG - Intronic
1113374283 13:109749766-109749788 AAGATGATAAAACCAGAGAAAGG - Intergenic
1113777191 13:112954519-112954541 CATAGGGTGAAACCAGAGGAGGG + Intronic
1114772143 14:25440197-25440219 AAGAGGACGAACTCACTGGAAGG - Intergenic
1115599782 14:34944405-34944427 AAGAGGAAGAAAAAAATGGAGGG + Intergenic
1117071270 14:52058874-52058896 GAGAGGGTGGAACCAGAGGAGGG + Intronic
1118433750 14:65749864-65749886 AAGAGAATGAAATCAGTTTAAGG + Intergenic
1119484558 14:74979340-74979362 AAGAGGCTGAAAGCTGTGGTAGG - Intergenic
1119495152 14:75071475-75071497 GAGAGGATGAAACTTGGGGACGG + Exonic
1120640317 14:87003013-87003035 AAGAAGATAAGACCAGTAGATGG - Intergenic
1121210685 14:92206268-92206290 AAGCGTATGGAAACAGTGGATGG - Intergenic
1121772864 14:96565859-96565881 AAAAGGAAGAAAACAGGGGAGGG - Exonic
1121989313 14:98539874-98539896 AACAGGATGCTGCCAGTGGAGGG - Intergenic
1122946852 14:105015252-105015274 AAGAGGATGAATTCAGTGCTTGG + Intronic
1127127929 15:55831389-55831411 CAGTGCATGAAATCAGTGGATGG + Intronic
1127327283 15:57907981-57908003 AAGAGGATGGAGACAGTGAAGGG + Intergenic
1127582874 15:60353689-60353711 AAGAGTATGACAGCAGTGCAAGG + Intronic
1128706189 15:69838969-69838991 GAGAGGGAGAAACCAGTGTATGG - Intergenic
1130225988 15:82058791-82058813 AAGAGGAGGAAACGAGAAGAGGG - Intergenic
1130282251 15:82529407-82529429 AAAAGAAAGAAACCAGGGGAAGG + Intergenic
1130863740 15:87914113-87914135 AAGAGGAAGAAATCAGGGCAAGG - Intronic
1132567967 16:631796-631818 AAGAGGATGGAAGAAGTGGATGG - Intronic
1132567984 16:631868-631890 AAGAGGATGGAAGAAGTGGATGG - Intronic
1132568001 16:631940-631962 AAGAGGATGGAAAAAGTGGATGG - Intronic
1132568037 16:632077-632099 AAGAGGATGGAAGAAGTGGATGG - Intronic
1134372002 16:13634577-13634599 AAGAGATTGGAGCCAGTGGAAGG - Intergenic
1134389086 16:13802144-13802166 AAGATGATGAAACCAATAAAAGG + Intergenic
1135622560 16:23968397-23968419 AAGAGGAAGAAGCAAGCGGAGGG + Intronic
1137841882 16:51648660-51648682 ACAAGGATGAAACCAGTGTCTGG + Intergenic
1138421318 16:56901133-56901155 TGCAGGAGGAAACCAGTGGAAGG - Intronic
1138509329 16:57498918-57498940 AAGATGATTAAAACAGTGGTTGG - Intergenic
1139987884 16:70915666-70915688 GAGAGGAAGGAACCAGTGGTGGG + Intronic
1140128104 16:72134535-72134557 AAGAGATGGAAGCCAGTGGAGGG - Intronic
1140248382 16:73271647-73271669 ATGAAGATGAAACGAGAGGATGG + Intergenic
1142929168 17:3267729-3267751 AAGACCATGAACCCACTGGAAGG + Intergenic
1143764856 17:9130725-9130747 AGGAGGAAGAAACCACTGGAGGG - Intronic
1146655525 17:34632570-34632592 AAGGGGAGGAGGCCAGTGGAAGG - Intronic
1147773836 17:42886461-42886483 AAGAGGAAGGAAGCAGAGGAAGG - Intergenic
1148002970 17:44400923-44400945 AAAAGGATGAAACGAGAAGAAGG - Exonic
1149250600 17:54764296-54764318 AAGAGTATGAAAGGAGGGGATGG + Intergenic
1149375638 17:56041463-56041485 AAGAGGATGAAACCTCTTGTTGG - Intergenic
1149614364 17:57986746-57986768 ACTAGGATGAATCCAGTGGCTGG + Intronic
1149857111 17:60092491-60092513 AATAGGAAGAAGACAGTGGAAGG - Intergenic
1150129956 17:62663752-62663774 GAAAGGATGGAACCAGTGCAAGG + Intronic
1150146431 17:62773488-62773510 AAGGGGAAGAAATAAGTGGAGGG + Intronic
1150179843 17:63106397-63106419 CAGAGGATAGAATCAGTGGATGG + Intronic
1151352125 17:73537927-73537949 AAGAGGATGAAGAGGGTGGAGGG + Intronic
1152201084 17:78946704-78946726 AAAAGGAGGGAAGCAGTGGAGGG + Intergenic
1152356177 17:79808697-79808719 AAGAGGAGGACTCCAGGGGAAGG + Intergenic
1152470657 17:80488860-80488882 GAGAGGATGGACACAGTGGAGGG + Intergenic
1152470740 17:80489149-80489171 GAGAGGATGGACACAGTGGAGGG + Intergenic
1152470818 17:80489398-80489420 GAGAGGATGGACACAGTGGAGGG + Intergenic
1152470895 17:80489647-80489669 GAGAGGATGGACACAGTGGAGGG + Intergenic
1152470905 17:80489683-80489705 GAGAGGATGGACACAGTGGAGGG + Intergenic
1152470972 17:80489896-80489918 GAGAGGATGGACACAGTGGAGGG + Intergenic
1153550786 18:6259259-6259281 AAGAGGATGACACCATTGATGGG + Intronic
1153672933 18:7429716-7429738 GAGAGGGGGAAACTAGTGGAAGG + Intergenic
1155730688 18:29154023-29154045 AAGAGGATAGAAACAGGGGATGG - Intergenic
1156185787 18:34661705-34661727 AAGAGGGTGGGAACAGTGGATGG - Intronic
1157958807 18:52129434-52129456 AAGATCATGAAACCAGAGTATGG + Intergenic
1158220382 18:55144455-55144477 AAGCTGATGCAACCAGTGAAGGG - Intergenic
1159467642 18:68805106-68805128 GATATGATGGAACCAGTGGATGG + Intronic
1160097423 18:75887854-75887876 CAGAGCAGGAAGCCAGTGGAAGG - Intergenic
1161608907 19:5229960-5229982 ATGAGGATGGAAGCAGTGTAGGG - Intronic
1163664553 19:18597142-18597164 AAGAGGAGGAAAACAGAGGCAGG - Intronic
1164426027 19:28142621-28142643 AAGAGGAGGAAAAAAGAGGAAGG + Intergenic
1166342350 19:42146283-42146305 GAGAGGAAGAGAACAGTGGATGG - Intronic
1168388178 19:55983529-55983551 AAGGTGCTGAAACCAGTAGATGG + Intronic
925058132 2:871219-871241 AAGAGGATGACACAGGTGGCGGG + Intergenic
925058142 2:871273-871295 AAGAGGATGACACAGGTGGCGGG + Intergenic
925058152 2:871327-871349 AAGAGGATGACACAGGTGGCAGG + Intergenic
925128189 2:1476726-1476748 AAGAGGTTGAACCCAGAGGATGG - Intronic
925308790 2:2867383-2867405 AAGACCATGAAGCCAGAGGAGGG - Intergenic
929470006 2:42182313-42182335 AGGAAGCAGAAACCAGTGGAGGG - Intronic
929852564 2:45605943-45605965 AAGAGTTTTAAACCATTGGAAGG - Intronic
930786071 2:55272609-55272631 AAGAGAATGAAAACAGTTAAAGG + Intergenic
931590186 2:63874519-63874541 AAGAGGAGGAAAACAGAGTATGG + Intronic
932497965 2:72156332-72156354 GAAAGAATGAAACCAATGGAGGG - Intergenic
933161056 2:79025789-79025811 GAGAAGATGAGACCTGTGGAAGG + Intronic
933185303 2:79271593-79271615 TAGAGGATCATACCAGTGGGTGG + Intronic
935079491 2:99778212-99778234 AGGAGGAGGAGACCAGAGGAAGG - Intronic
935092084 2:99904997-99905019 AGGAGGAAGAAGCCAGTGGTGGG - Intronic
935257780 2:101327691-101327713 AAGAGGAAAAGACTAGTGGAAGG + Intergenic
936677854 2:114736213-114736235 AAGAAGAGGAAAGCAGTGGAGGG - Intronic
937771926 2:125729367-125729389 AAGAGCAGGAACCCACTGGAAGG + Intergenic
937975356 2:127579021-127579043 AAAAGGAAGAACCCAATGGATGG + Intronic
938404813 2:131025561-131025583 CAGATGAAGAAACCAATGGAAGG - Intronic
938592742 2:132755196-132755218 AAGAGGATGAAGGCACTGAATGG + Intronic
939023957 2:136989715-136989737 GAGAGGCTGGAACCCGTGGAAGG + Intronic
939213151 2:139204206-139204228 AAAAGGATGGAACCACTGAATGG + Intergenic
939294027 2:140234170-140234192 ATGAGGATGAAAACAGTTGATGG + Intronic
941225479 2:162841745-162841767 AATAGAATAAAACCAGTGGATGG + Intergenic
942011212 2:171764191-171764213 AAGAGCATTAAACTTGTGGATGG + Intergenic
943102667 2:183507519-183507541 AAGACCATGAACCCACTGGAAGG - Intergenic
943190836 2:184678817-184678839 AATAGGATGGAAACAGTTGAGGG + Intronic
944805838 2:203280326-203280348 AAGAGGATGAATCACGAGGATGG + Intronic
944874833 2:203951778-203951800 CAGAAGATAAAATCAGTGGACGG - Intronic
945452041 2:210005044-210005066 CAAAGGAGGAAACCAGTGTAGGG + Intronic
947821978 2:233078496-233078518 AAGAGGATGAAGCCATTTGGGGG + Intronic
1168738824 20:170084-170106 AACAAGATGTAACCATTGGAGGG + Intergenic
1168790328 20:571969-571991 AAGAAGAGGAAAACAGTGGCTGG - Intergenic
1169621631 20:7513499-7513521 AAGAGGAAGAAATTAGTGGAAGG - Intergenic
1169646804 20:7820145-7820167 TAGAGGACAAAACCAGAGGATGG + Intergenic
1169736260 20:8840680-8840702 TAGAAAATGAAATCAGTGGAGGG - Intronic
1170259154 20:14383074-14383096 AAGAGGATGTAAGAATTGGAGGG + Intronic
1170471664 20:16674113-16674135 AAGGGGAGGAAACAAGTGGGAGG - Intergenic
1172437538 20:34940329-34940351 AAGAGAGTGAAGCCAGGGGATGG - Intronic
1173245639 20:41335650-41335672 AAGATGATGAAACCTGAGGTGGG - Intergenic
1173566005 20:44039166-44039188 AAGAGGGTGAGGCCAGAGGATGG + Intronic
1173881094 20:46412778-46412800 AAGAGGATGAACACAATGGATGG - Intronic
1174355275 20:49993701-49993723 AAAGGGATGAAACTTGTGGATGG - Intergenic
1176925758 21:14746682-14746704 TGGAGGATGGACCCAGTGGAAGG - Intergenic
1177778625 21:25598633-25598655 AAGAGGATGGAAAGAGGGGAGGG - Intronic
1177793940 21:25752934-25752956 AAGTGGATGAAAACAGTGATAGG + Intronic
1178259189 21:31083189-31083211 GAGAGGATGAACCCACTGGGAGG - Intergenic
1178712862 21:34934804-34934826 AAGAGGATGAAGGCAGGGGTGGG + Intronic
1178771560 21:35509489-35509511 TAGAGGATGAAACCAGGGTTGGG + Intronic
1179010495 21:37552552-37552574 AAGAGGATGAAGGCAGAGCAGGG + Intergenic
1179503986 21:41828009-41828031 AAGAGGATGAGCCCATCGGATGG + Intronic
1182533222 22:30978687-30978709 TAGAGAATGAAGCCAGTGCAGGG + Intergenic
1183783620 22:40016090-40016112 AAAAGGATGAAATCAGGAGAGGG + Intronic
1184909893 22:47524061-47524083 AAGAGGAGTAAATAAGTGGAAGG + Intergenic
952359243 3:32613428-32613450 AAGAGGAAGAGTCCTGTGGAAGG + Intergenic
953592308 3:44270031-44270053 AAGAGGTTGAAAACAGCAGAGGG + Intronic
953622306 3:44543601-44543623 AAGACCAAGAACCCAGTGGAGGG - Intergenic
953675367 3:44997318-44997340 AAGAGGAAAAAAGCACTGGAAGG - Intronic
953875117 3:46662291-46662313 AGGAGGAGGACACCAGTGCAGGG + Intergenic
954598608 3:51850446-51850468 AAGACCATGAACCCACTGGAAGG + Intergenic
954645358 3:52128102-52128124 AAGAGAAGGAAACCAGTACATGG + Intronic
954975933 3:54694749-54694771 AAGGGAATGAAAACAGAGGAGGG - Intronic
956332267 3:68124689-68124711 CAGAGAAGGAAACCAGTGGCTGG + Intronic
956574094 3:70732398-70732420 AAGATAATGAAACCAGGGGAAGG - Intergenic
956648396 3:71479869-71479891 CAGATGATGAAAGCAGTGGTAGG - Intronic
956842370 3:73152534-73152556 AAGACCATGAACCCACTGGAAGG - Intergenic
959373087 3:105554071-105554093 CAGAGAATCAAACCAGTAGAGGG + Intronic
960297904 3:115966941-115966963 AAGGGGATGAAACCAGGGAAGGG + Intronic
961637656 3:128343225-128343247 CAGAGGAGAAAACCTGTGGACGG - Intronic
963931568 3:151009171-151009193 AAGAGCATTAAAGCATTGGACGG + Intergenic
965079564 3:164019863-164019885 AAGAGGGTGAAACCGCAGGATGG + Intergenic
965679200 3:171233103-171233125 AGGAGGATGAAGACAGTGGGGGG - Intronic
966073755 3:175910210-175910232 GAGAGGTTGAAATCAGTGCATGG + Intergenic
966529004 3:180952935-180952957 AAGAGGCTGAGGCCAGAGGATGG - Intronic
968874270 4:3257054-3257076 AAGAGTTTGAAACTGGTGGAAGG - Intronic
968963965 4:3760152-3760174 ATGAGGATGAAAACCATGGAAGG - Intergenic
971531277 4:27692526-27692548 AAGAGGAACAATCCAGTGGGTGG + Intergenic
971808542 4:31393648-31393670 AAGCGGCTCAAGCCAGTGGACGG + Intergenic
972966836 4:44520583-44520605 AATGGGATGAGACCAGAGGATGG + Intergenic
973833485 4:54785818-54785840 AAAAGGAAAAAAACAGTGGAGGG - Intergenic
974633982 4:64534644-64534666 TGGAGGATGAAACCAGAGCAAGG + Intergenic
975060553 4:69992714-69992736 AAGAGGATGAAACATCAGGAAGG - Intergenic
975202361 4:71606883-71606905 AAGACCATGAACCCACTGGAAGG - Intergenic
975216623 4:71762626-71762648 CATAGGAAGAAACCAGTGGAAGG + Intronic
975906390 4:79217879-79217901 AAGAGGAAGAAACAAAGGGAGGG + Intergenic
976138642 4:81966101-81966123 TCGGGGATGAAACCCGTGGAGGG - Intronic
978160719 4:105544750-105544772 AAGAGGATGAAAACATTAGAAGG + Intergenic
978231110 4:106401110-106401132 AGGAGGATGGAAGCAGTGGAAGG + Intergenic
980760264 4:137223437-137223459 AAGACGATGAACCCACCGGAAGG + Intergenic
981665447 4:147219979-147220001 AATAGGATCAAACCAGAAGAAGG + Intergenic
982488835 4:156002433-156002455 GAGACCATGAACCCAGTGGAAGG + Intergenic
983537100 4:168869458-168869480 AGAAGGATGAAGACAGTGGATGG + Intronic
983561782 4:169108878-169108900 AAGAGGATGAAACCAGTGGAAGG + Intronic
987442963 5:17979869-17979891 TAGAGGTTGAAACAAGAGGATGG - Intergenic
989447564 5:41548600-41548622 AAGATGAAGGAGCCAGTGGATGG + Intergenic
989600218 5:43193397-43193419 AGGAGGACGAAAACAGGGGAGGG - Exonic
991131574 5:63128375-63128397 AAGAGGAAGAAAACAGTCCAGGG - Intergenic
992980782 5:82169231-82169253 AAGTGAATGAGACCAGAGGAAGG + Intronic
993299399 5:86188898-86188920 AAGAGCATAAAAGCAGAGGATGG + Intergenic
994725385 5:103429159-103429181 ATGAGTATGAAAACACTGGAGGG + Intergenic
994782161 5:104104356-104104378 AAGACCATGAACCCATTGGAAGG - Intergenic
995349772 5:111161723-111161745 CAGGGGAGGAACCCAGTGGAAGG + Intergenic
996417312 5:123224159-123224181 AAGAGTATGACACCAGGGTATGG - Intergenic
998064907 5:139150309-139150331 AGGAGGATGAGACGTGTGGAGGG - Intronic
1001407614 5:171487012-171487034 AAGAGGATGGAAGCACAGGATGG + Intergenic
1001413856 5:171529350-171529372 ATGAGGAGGAAGCCAGAGGAAGG - Intergenic
1002103023 5:176866642-176866664 GAGAGGATGAAGGGAGTGGAGGG + Intronic
1002595326 5:180318279-180318301 AACAGTAGGAAACCATTGGAGGG + Intronic
1002874370 6:1198638-1198660 AAGAGGATGGAACCAGTTCATGG - Intergenic
1003352724 6:5333701-5333723 AAGAGAATCAAAACAGTGGCCGG - Intronic
1005029798 6:21498217-21498239 AAGAGAATGAAAGCAGGGTATGG - Intergenic
1005361388 6:25034672-25034694 AAGAAAATGAAACCAGCAGAGGG - Intronic
1005706720 6:28462078-28462100 AACAGAATGAAAACAGTGTAGGG + Intergenic
1006073886 6:31516716-31516738 AAGAGGAAGAAGCCGGTGGAGGG - Intergenic
1006778349 6:36614296-36614318 GAGAGGCCGAAACAAGTGGATGG - Intergenic
1007703574 6:43778150-43778172 GAGAGGATGAAAGAAGGGGAGGG + Intronic
1007941957 6:45789656-45789678 AAGTGGATGAACCCATTGGCTGG + Intergenic
1010966381 6:82213886-82213908 AAGGGGATGGAACAAGTGGGAGG + Intronic
1012477850 6:99634704-99634726 TAGAGGTTGTAACCAGTGGTTGG + Intergenic
1014247271 6:119081850-119081872 AAGAGGAGCACATCAGTGGAGGG - Intronic
1014323771 6:119966189-119966211 AAGAGGAACACACCAGCGGAAGG + Intergenic
1014565821 6:122946567-122946589 CAGAGGATGAAAGGGGTGGATGG + Intergenic
1015169387 6:130234681-130234703 TAGGGGAGGAAACCAGTGGTAGG - Intronic
1015198675 6:130553529-130553551 ATGAGGATAAAACCAATAGAGGG - Intergenic
1019055271 6:169218900-169218922 AAGTGGATGAGATGAGTGGATGG + Intronic
1022627856 7:32056548-32056570 CAGATGAGGAAACCAGTGGTTGG - Intronic
1024201939 7:47117035-47117057 AAGAGGCTGAAAGCAGAGGTTGG - Intergenic
1025264253 7:57442112-57442134 AAGAGGACGAAATGAGAGGATGG - Intergenic
1025614025 7:63102661-63102683 AAGAGGACAAAGCCAGGGGAGGG - Intergenic
1026540907 7:71279228-71279250 ATTAGGATGAATCCAGTGGCTGG - Intronic
1026877338 7:73887148-73887170 AGGGAGATGAAACCAGGGGAAGG - Intergenic
1028833337 7:95348563-95348585 ATAAAGAAGAAACCAGTGGATGG + Intergenic
1029290916 7:99501623-99501645 GAGAGGATGAACCCACTGGAAGG + Intronic
1029502119 7:100938139-100938161 GTTAGGATGAGACCAGTGGATGG + Intergenic
1030381816 7:108820522-108820544 AAGAGAATGAAAACAGAGAAAGG - Intergenic
1030528048 7:110676984-110677006 AACATGATGCAACAAGTGGAGGG + Intronic
1032322983 7:130901247-130901269 AATAGAATGCAACCAGAGGAGGG - Intergenic
1032804294 7:135339782-135339804 AGCAGGAAGAAAGCAGTGGAGGG + Intergenic
1032927878 7:136629702-136629724 AAGACCATGAACCCACTGGAAGG + Intergenic
1034352704 7:150427804-150427826 AAGAGGATTTACCCAGTGAAGGG - Intergenic
1036203041 8:6785128-6785150 AAGAGGAACAAAGGAGTGGATGG - Intergenic
1036467402 8:9013523-9013545 AAGAGGATGTAAGCAGAGAACGG - Intronic
1036667809 8:10759132-10759154 AAGTGGATGACACCTGTGGCGGG + Intronic
1036741532 8:11366318-11366340 AAGATGATGTAACCAGCGAAGGG + Intergenic
1037093614 8:14954405-14954427 AGGAAAATGAAACCAGTGGCAGG - Intronic
1038846841 8:31237870-31237892 GAGAGGATGTGACCAGTGGAAGG - Intergenic
1040106306 8:43544259-43544281 CAGGGGATGATAGCAGTGGATGG - Intergenic
1040980939 8:53245680-53245702 AAATGGATGAAACCATTGAAAGG + Intronic
1043753781 8:83975727-83975749 AAGAGGAGGAAAAAAGAGGAGGG + Intergenic
1044407286 8:91842781-91842803 AAGCAGATGAAACCAAAGGATGG + Intergenic
1044454015 8:92370620-92370642 CAGGGGATGAAACCACTGTAGGG + Intergenic
1044611855 8:94099428-94099450 AGGAGGATGAAACCAGGGAAAGG + Intergenic
1044651789 8:94503696-94503718 AAGAGGATAATACAAGTGTAAGG + Intronic
1045502412 8:102753710-102753732 AAGAGGCTGACGCCAGAGGATGG + Intergenic
1046112360 8:109740500-109740522 AAGAGGCTTACAACAGTGGAGGG - Intergenic
1047437903 8:124850229-124850251 AAGAGGAAGAATTCTGTGGATGG - Intergenic
1047561255 8:125990019-125990041 AAGAGGAAGAAACGAGTGTGAGG + Intergenic
1047745267 8:127840167-127840189 AGGAGCAGGAAGCCAGTGGAGGG + Intergenic
1047863625 8:128996249-128996271 AAGAGGAAGATATCAGGGGAAGG + Intergenic
1048210409 8:132449968-132449990 AAGACTGTGAACCCAGTGGAAGG - Intronic
1049306453 8:141906778-141906800 AGCAGGAAGAAAGCAGTGGATGG - Intergenic
1051523820 9:18020242-18020264 AAGAGAATGATGCCAGTAGATGG - Intergenic
1055781054 9:79822281-79822303 AAGAGGATGAAAAAACAGGAAGG + Intergenic
1056544984 9:87606049-87606071 AAGAGGCTGAATTCAATGGATGG - Intronic
1056920328 9:90782080-90782102 AGGAGGAAGTAACTAGTGGAAGG + Intergenic
1057847976 9:98540027-98540049 ATGAGAGTGAAACAAGTGGATGG - Intronic
1057990198 9:99760976-99760998 AAGAGGAGGAAACTTGTGGGAGG - Intergenic
1058629831 9:106975209-106975231 AAGAGGATGAAAAGAAGGGATGG - Intronic
1058854225 9:109044474-109044496 AAGAGGGTGGAACCAGTGTAAGG - Intronic
1060051025 9:120378395-120378417 AACAGGAAGAAGCCAGAGGAAGG - Intergenic
1060371275 9:123074346-123074368 AAGAGTAAGAAACCACTGGGAGG - Exonic
1203771571 EBV:52434-52456 AAGAAGATGAAGCCGGTGGGTGG + Intergenic
1186048076 X:5557814-5557836 AAGAGGAAGAAACTAAGGGAAGG + Intergenic
1187101023 X:16192024-16192046 AAGAGGATGAAAGGACTGGAGGG - Intergenic
1187962612 X:24581183-24581205 AAGAGCAGAAAGCCAGTGGAGGG - Intronic
1188300155 X:28497699-28497721 TAGAGCATGGAACCAGTGGTTGG + Intergenic
1188600619 X:31959155-31959177 AAGAGAGTGAAACTAGTGGCAGG - Intronic
1188979533 X:36714654-36714676 AAGAGGTTGAAACCAGCTTAAGG + Intergenic
1189020770 X:37336471-37336493 AAGAAGATGAAAACAAAGGAGGG + Intergenic
1189615215 X:42776268-42776290 AAGCAGATGAAAACATTGGAGGG - Intergenic
1189704803 X:43749294-43749316 AAGAGGATGAAAACAAAGGAAGG + Intergenic
1191041575 X:56086968-56086990 AAGAGCATGAAACCAGTCACTGG + Intergenic
1191192414 X:57680493-57680515 AAGAGGCTGAGACGAGAGGATGG + Intergenic
1191689457 X:63925061-63925083 AAGAGGATAAGAAAAGTGGAAGG + Intergenic
1192218975 X:69184134-69184156 AGGAGACTGAAACAAGTGGATGG - Intergenic
1192596156 X:72410494-72410516 AAGAAGATGAAATCAGTGGTTGG + Intronic
1192734049 X:73831651-73831673 AAGAGGTTGAAACTAATGGAAGG + Intergenic
1194066592 X:89269210-89269232 AAGACCATGAACCCACTGGAAGG - Intergenic
1194461677 X:94177294-94177316 AAGGTGATGAAATCAGTGAATGG + Intergenic
1197727469 X:129785943-129785965 AAGAGGAGGAAATAAATGGAAGG + Intronic
1197787247 X:130211297-130211319 CAGAGGGTGAAACGAGAGGAAGG + Intronic
1198279523 X:135127860-135127882 AAGAGGAGGAAACCAGAGAGGGG + Intergenic
1198291434 X:135244654-135244676 AAGAGGAGGAAACCAGAGAGGGG - Intergenic
1200720762 Y:6603364-6603386 AAGACCATGAACCCACTGGAAGG - Intergenic
1201147732 Y:11074111-11074133 GAGATGGTGACACCAGTGGAGGG - Intergenic
1201464651 Y:14267219-14267241 AGGAGGAAGTAACCTGTGGAAGG + Intergenic