ID: 983561783

View in Genome Browser
Species Human (GRCh38)
Location 4:169108882-169108904
Sequence GGATGAAACCAGTGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983561776_983561783 20 Left 983561776 4:169108839-169108861 CCTACACCTACTAAAGCTTAGAG 0: 1
1: 1
2: 1
3: 4
4: 99
Right 983561783 4:169108882-169108904 GGATGAAACCAGTGGAAGGAAGG No data
983561778_983561783 14 Left 983561778 4:169108845-169108867 CCTACTAAAGCTTAGAGGCTGAG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 983561783 4:169108882-169108904 GGATGAAACCAGTGGAAGGAAGG No data
983561775_983561783 21 Left 983561775 4:169108838-169108860 CCCTACACCTACTAAAGCTTAGA 0: 1
1: 0
2: 0
3: 9
4: 81
Right 983561783 4:169108882-169108904 GGATGAAACCAGTGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983561783 Original CRISPR GGATGAAACCAGTGGAAGGA AGG Intronic
No off target data available for this crispr