ID: 983561783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:169108882-169108904 |
| Sequence | GGATGAAACCAGTGGAAGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983561776_983561783 | 20 | Left | 983561776 | 4:169108839-169108861 | CCTACACCTACTAAAGCTTAGAG | 0: 1 1: 1 2: 1 3: 4 4: 99 |
||
| Right | 983561783 | 4:169108882-169108904 | GGATGAAACCAGTGGAAGGAAGG | No data | ||||
| 983561778_983561783 | 14 | Left | 983561778 | 4:169108845-169108867 | CCTACTAAAGCTTAGAGGCTGAG | 0: 1 1: 0 2: 1 3: 6 4: 96 |
||
| Right | 983561783 | 4:169108882-169108904 | GGATGAAACCAGTGGAAGGAAGG | No data | ||||
| 983561775_983561783 | 21 | Left | 983561775 | 4:169108838-169108860 | CCCTACACCTACTAAAGCTTAGA | 0: 1 1: 0 2: 0 3: 9 4: 81 |
||
| Right | 983561783 | 4:169108882-169108904 | GGATGAAACCAGTGGAAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983561783 | Original CRISPR | GGATGAAACCAGTGGAAGGA AGG | Intronic | ||
| No off target data available for this crispr | |||||