ID: 983562825

View in Genome Browser
Species Human (GRCh38)
Location 4:169118065-169118087
Sequence TCCAGGGCCTTGAAAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983562825_983562832 8 Left 983562825 4:169118065-169118087 CCACTGACTTTCAAGGCCCTGGA 0: 1
1: 0
2: 0
3: 27
4: 202
Right 983562832 4:169118096-169118118 CTTCATCTACAGAACAAGCTAGG 0: 1
1: 0
2: 3
3: 30
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983562825 Original CRISPR TCCAGGGCCTTGAAAGTCAG TGG (reversed) Intronic
901228210 1:7626867-7626889 TCCAGGGTCCTGCAAGTCAGGGG - Intronic
901508869 1:9704410-9704432 CCATGGGCTTTGAAAGTCAGGGG - Intronic
902774888 1:18668265-18668287 GCCAGGACGTTGAAATTCAGAGG - Intronic
902807247 1:18868793-18868815 GCCAGGGGCTTGGGAGTCAGAGG + Intronic
902825922 1:18974194-18974216 TCCAGCCCCTTGAAAATCAGAGG + Intergenic
906224957 1:44114068-44114090 GCCTGGGCCTTGTAGGTCAGAGG - Intergenic
908076330 1:60523459-60523481 TTCAAGGCTTTGAAAGTGAGTGG - Intergenic
908555835 1:65255388-65255410 TCCGAGGCATTGCAAGTCAGCGG + Intronic
909260584 1:73484141-73484163 TCTAGGAGCTTGAAAATCAGTGG - Intergenic
909367477 1:74844691-74844713 TCCAGGCCCTTTAAAGTATGGGG - Intergenic
909660962 1:78081521-78081543 ACCAGGGACTTGAACATCAGTGG + Intronic
909827255 1:80142146-80142168 TGCAGGCCCTTGAAAGTCGAGGG - Intergenic
911116593 1:94251977-94251999 TCCAGGGGCTGGAAACACAGTGG - Intronic
911815663 1:102346628-102346650 TCCAAGAGCTTGAAAGGCAGAGG + Intergenic
913937505 1:125067546-125067568 TCCAGGCCCCTGAAAAACAGGGG - Intergenic
914898055 1:151694567-151694589 TCCAGAGACATGAAATTCAGAGG - Exonic
917055718 1:170978854-170978876 TCCAGGTTCTTGAGAGTCTGTGG - Intronic
917672063 1:177282174-177282196 TCCAGGGCCCTGAAACTTGGTGG - Exonic
918077634 1:181182468-181182490 TCCAAGGCCCTGAAAGACAGTGG + Intergenic
919170615 1:193949151-193949173 TCCAGAGGCTTGAGAATCAGGGG + Intergenic
920786909 1:209050792-209050814 TCCAGGTCCTGGAAAATCCGAGG + Intergenic
923135669 1:231116356-231116378 TCCAGGACTTTGAAAGTCCAAGG + Intergenic
923845725 1:237729448-237729470 TGAAGGGCCTTGGAAATCAGAGG - Intronic
1067101333 10:43336833-43336855 GCCATTGCCTTGCAAGTCAGTGG + Intergenic
1067556680 10:47277932-47277954 TCCAGGTCCTGGAAACTCAGAGG - Intergenic
1069163804 10:65123809-65123831 TCCAGAGCCTTCAAAGGCAGCGG + Intergenic
1070149003 10:73794030-73794052 ACCAAGGCCTTGGAGGTCAGAGG + Exonic
1071119309 10:82259675-82259697 CCCAGAGCTTTGAAAGGCAGAGG + Intronic
1071298933 10:84242125-84242147 TCCAAGGCCTTGACAGCCTGTGG + Intergenic
1071921098 10:90351635-90351657 ACCAGGGACTTGAACATCAGTGG + Intergenic
1072691183 10:97573130-97573152 TCCTGGGCCTTGAGAGACAGTGG + Intronic
1073217968 10:101847154-101847176 GCCAGCACCCTGAAAGTCAGTGG - Exonic
1073567738 10:104549693-104549715 TCCAGGAACTTGACACTCAGTGG + Intergenic
1074455112 10:113589620-113589642 CCCATGGCCTTGCAAGCCAGGGG + Intronic
1075750398 10:124765454-124765476 TCCAGGGTGTTGAAAGTAAAAGG - Exonic
1076903353 10:133350585-133350607 ACCTGGGCCTTGAAGGCCAGAGG + Intronic
1076944033 10:133631673-133631695 TCCAGCACTTTGAAAGGCAGAGG + Intergenic
1079386902 11:19988658-19988680 TCCAGGGCCTTGGCACTCAGAGG + Intronic
1079476597 11:20836785-20836807 TCCAGGGCTTTGGGAGTTAGGGG + Intronic
1080023190 11:27585769-27585791 TCCCAGTCCTTGAAAGTCTGTGG - Intergenic
1081071592 11:38616630-38616652 CCCAGGGCTTTGAAAGGCTGAGG - Intergenic
1082033493 11:47624835-47624857 TCCAGCGCTTTGGAAGTCCGAGG + Intronic
1084398636 11:68931130-68931152 CCCAGGGCCATGAATGGCAGCGG - Intronic
1090166904 11:124559180-124559202 TCATGGGCCTTGAAAGTGAAGGG - Intergenic
1091319578 11:134640148-134640170 TCCAGGGCCCTGTGAGTCATGGG - Intergenic
1093587135 12:20852222-20852244 CCCAGGGCTTTGGAAGTCTGAGG + Intronic
1095730719 12:45504102-45504124 TCCAGTGCCTTGCACGTCAGAGG - Intergenic
1095980587 12:47972291-47972313 TCCAGGTCATTGAAAGGCAAGGG + Intergenic
1096602838 12:52742452-52742474 CCCAGGGCCATGAATGGCAGTGG + Intergenic
1097241696 12:57580171-57580193 AGCAGGGCCTTGGAAGACAGCGG - Intronic
1097266427 12:57748103-57748125 TACAGGGCCTAGGAAGTCAGTGG - Exonic
1097316925 12:58181491-58181513 TCCATGGCCATGATAGTCACCGG + Intergenic
1099752592 12:86796535-86796557 TCCAGGGGCTGGAAAGACATTGG + Intronic
1100030847 12:90189037-90189059 TCAAGAGCCTGGAAAGTCTGGGG + Intergenic
1100878043 12:98983805-98983827 TCCCAGGCCTTGAAACTCAGTGG - Intronic
1101023310 12:100574483-100574505 TAGAGTGCCTTGGAAGTCAGAGG + Intronic
1102085514 12:110135167-110135189 TCCAGGTCCTTGAAAGTGCTGGG - Intronic
1103542114 12:121673243-121673265 ACCAGGGCCTTGAAGGCCACTGG - Intergenic
1103659986 12:122506492-122506514 TCCAGGGCTTTGAGAGGCCGAGG + Intronic
1104285025 12:127417395-127417417 TCCAGACCCTTGGAAGTCAGAGG - Intergenic
1105801551 13:23907558-23907580 TACAGGGCCTTAAAAGCCATTGG + Intergenic
1106879141 13:34110137-34110159 TGCAGGGTCTTGAAAGTCATGGG + Intergenic
1110122903 13:71905326-71905348 TCCAGTGCTTTGAGAGGCAGAGG - Intergenic
1111182520 13:84687393-84687415 TCCAGGGCTTTGGGAGTCACAGG - Intergenic
1111693773 13:91597158-91597180 TCCAGCACCTTGAAAATCATTGG + Intronic
1112682876 13:101787492-101787514 TCCAGGGGTTTGTAACTCAGTGG - Intronic
1114173118 14:20294585-20294607 TCCAGTGCCTAGAAAGACAATGG + Intronic
1114584864 14:23801971-23801993 CCCAGGGCCTTGGAAAGCAGAGG + Intergenic
1114672231 14:24417417-24417439 TCCAAGACCTTGAAGGACAGCGG - Exonic
1117127786 14:52649712-52649734 TCCAGGAACTAGAAAGTGAGGGG - Intronic
1118834475 14:69467160-69467182 TCCAGGGGCCAGAAAGTTAGAGG - Intergenic
1120304935 14:82757691-82757713 TCCACTTCCTTCAAAGTCAGAGG - Intergenic
1121671339 14:95712689-95712711 TCCAGTGCTTTGGAAGGCAGAGG + Intronic
1121694275 14:95900217-95900239 TCAAGGGCCCTGCAACTCAGAGG + Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1122235019 14:100326462-100326484 TTCAGGTCTTTGAAAGTCGGAGG + Intronic
1124937540 15:34186776-34186798 CCCAGGGCCATGAATGGCAGCGG + Intronic
1127017788 15:54708271-54708293 CCCAGGGCCATGAATGGCAGCGG - Intergenic
1129514976 15:76151869-76151891 TCCAGGTCCTCGATACTCAGTGG - Intronic
1131107264 15:89743740-89743762 TCCAGGGCCTAGGAGGTGAGTGG - Intergenic
1131419340 15:92291172-92291194 ACCTGGGCCTTGAAGGACAGGGG - Intergenic
1131623844 15:94097067-94097089 TTCAGGGCCTTGTAGGACAGAGG + Intergenic
1132415135 15:101614030-101614052 AGCAGGGCCCTGAGAGTCAGAGG - Intergenic
1134820574 16:17243784-17243806 TCAAGGGCTGAGAAAGTCAGAGG + Intronic
1136169874 16:28482465-28482487 ACCAGGGACTTGTAAGTGAGGGG - Exonic
1139955440 16:70690876-70690898 TCCAGGGCATTGAAGGCTAGGGG + Intronic
1140525845 16:75622313-75622335 CCCTGTGACTTGAAAGTCAGAGG + Intronic
1140593985 16:76386843-76386865 CCAAGGGCCTTAAAAGTCAAAGG + Intronic
1144298837 17:13904270-13904292 AACAGGGCCTTGAAAGACAAAGG - Intergenic
1147218998 17:38917338-38917360 TCAAGGGCAGTGAAGGTCAGGGG + Intronic
1148043878 17:44730310-44730332 TTACGGGACTTGAAAGTCAGAGG + Intronic
1148758293 17:49986053-49986075 TCTAGGGTCTTGGAAGTCAGGGG + Intergenic
1149949320 17:60968483-60968505 TCCAGTGCCTTGAAAGGCCAAGG - Intronic
1152365136 17:79851180-79851202 GGCAGGGCCTTGGATGTCAGAGG - Intergenic
1152426466 17:80220929-80220951 TCCAGGGCTGTGAAAGCCACAGG + Exonic
1152667697 17:81580760-81580782 TCCAGGGCCTGGCAATTCACAGG + Intronic
1152986967 18:329959-329981 TCCAGGGACTTGGGAGTCTGAGG + Intronic
1154380896 18:13848926-13848948 TGCAGGGCCGTGAAAGACAGGGG + Intergenic
1157207142 18:45710334-45710356 AGAAGGGCCCTGAAAGTCAGTGG - Intergenic
1157700199 18:49757458-49757480 TGCAGTGCATTCAAAGTCAGAGG - Intergenic
1157731995 18:50011888-50011910 TGCAGGGCCTGGAGTGTCAGAGG - Intronic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161766501 19:6211648-6211670 TGAAAGGACTTGAAAGTCAGGGG + Intergenic
1162875437 19:13617817-13617839 TTCAGGGTGGTGAAAGTCAGAGG - Intronic
1163252562 19:16134869-16134891 CCCAGTGCCTTGAGAGGCAGAGG + Intronic
1163524867 19:17814670-17814692 TCCAGGGCTTTGGGAGGCAGAGG + Intergenic
1163839952 19:19601396-19601418 CTAAGGGCCTTGAAAGTCATGGG + Intronic
1164398751 19:27888401-27888423 GCCAGGATCTTGGAAGTCAGAGG + Intergenic
1167638435 19:50667917-50667939 TCCAGGGCCTTGCCGGTCAGCGG + Exonic
1168099697 19:54134380-54134402 GACAGGACCTAGAAAGTCAGAGG - Intergenic
928347681 2:30516360-30516382 TCCAGAGCGGTGAAAGTCAATGG - Intronic
930048953 2:47199057-47199079 TCCAGGGACTGGAAAGTCGGGGG - Intergenic
931181579 2:59906802-59906824 TCCAGGGCCTAGAATGGCATAGG - Intergenic
932321666 2:70826989-70827011 TGGAGGGCCTTCAAAGCCAGAGG - Intergenic
934721812 2:96583570-96583592 TCCAGGTCATTGCATGTCAGTGG + Intergenic
936562208 2:113549940-113549962 TCCGGGGCCTTAAAACTGAGAGG - Intergenic
937859167 2:126694875-126694897 CTCAGGACCTTGAAAGTGAGGGG - Intronic
937899326 2:127005619-127005641 GCAAGGGCCTTTAAAGGCAGGGG - Intergenic
938212974 2:129484131-129484153 TCCAGGGCCATGTAGATCAGTGG - Intergenic
938322531 2:130374652-130374674 TCCAGAGACCTGAAAGTGAGAGG - Exonic
939164267 2:138623129-138623151 TCCAGGGCCTGGATATTTAGAGG + Intergenic
939760021 2:146163671-146163693 ACCTGGGCCTTGGAAATCAGTGG + Intergenic
940674760 2:156714549-156714571 TCCAGGTCCTGGAAAATCCGAGG - Intergenic
945041569 2:205747118-205747140 TCCAGGAGCTTGTAAGCCAGTGG + Intronic
945539015 2:211059913-211059935 CCCAGGACACTGAAAGTCAGGGG - Intergenic
946110217 2:217408401-217408423 TCCAGGGTGTTGAAGGTCACCGG + Intronic
948202019 2:236136217-236136239 TCCATGGCCTTGGAGCTCAGGGG - Intergenic
948298025 2:236877989-236878011 TCCAGGACTTTGAAAGGCCGAGG + Intergenic
949032714 2:241804563-241804585 GCCAGGGCCGGGAAATTCAGGGG - Intergenic
1170696370 20:18662968-18662990 TCCAGGGCCTGGAGAGGCTGGGG + Intronic
1171481612 20:25459432-25459454 TCCAGGGCCTGGAAAATGTGGGG - Intronic
1171781386 20:29421789-29421811 TCCAGCACTTTGAAAGGCAGAGG + Intergenic
1171843507 20:30244993-30245015 TTCAGGGCCTGGAAAGGCAAAGG - Intergenic
1172106566 20:32520547-32520569 GCCGGGGCCTTGCAAGGCAGGGG + Intronic
1173504310 20:43574994-43575016 TCCATGGCCTGGTGAGTCAGGGG + Exonic
1173575348 20:44109885-44109907 TCCAGGGCAGTGAAAGGGAGGGG - Intergenic
1174034572 20:47660721-47660743 TCCAGGGCTTTGGAAGGCTGAGG - Intronic
1174036799 20:47673526-47673548 ACCAGGGCCTTCAACGGCAGCGG - Intronic
1174930331 20:54806433-54806455 TCCAGGGGCTTCAAATTCAGAGG - Intergenic
1177141383 21:17361590-17361612 CCCAGTGCTTTGAGAGTCAGAGG + Intergenic
1182004972 22:26952330-26952352 TCCAGGGCCATGCATTTCAGAGG - Intergenic
1182625978 22:31646371-31646393 CCCAGGGCCTGGAAAGTGACAGG - Intronic
1182709254 22:32310416-32310438 TGCAGTGCCTTGGAAGGCAGAGG - Intergenic
1182893077 22:33835318-33835340 TCCAGGGAGTTGAAAATCACAGG - Intronic
1184113768 22:42410161-42410183 TCCAAGTCCTTGGAAGGCAGAGG + Intronic
950261272 3:11544628-11544650 TCCAGGGCCCAGAAGGACAGGGG - Intronic
950418016 3:12879676-12879698 AGCAGGGCCTGGAAAGTCAGTGG - Intergenic
951001729 3:17570009-17570031 TACAGGTACTAGAAAGTCAGAGG + Intronic
951838602 3:27009013-27009035 TTCATGGCCTTGAGAGTTAGTGG + Intergenic
953015651 3:39073401-39073423 TCAAGGGCCCTTAAAGTCATGGG + Intronic
953492983 3:43365540-43365562 TCCAGGGCCTTGTTATTCGGCGG - Intronic
953923839 3:46970438-46970460 TTCAAGGGCTTGAAAGTCACAGG + Intronic
953925624 3:46980978-46981000 TCCAGGTCCGTGGAAGACAGTGG - Intronic
954033502 3:47837274-47837296 TCCAGGGCCTTCACTGTCACAGG + Intronic
954426584 3:50446588-50446610 ACCAGGGCTATGAAAGTCAGCGG + Intronic
956852024 3:73237672-73237694 TCCAGACCCAGGAAAGTCAGTGG + Intergenic
957447175 3:80328273-80328295 TCAAAGGACTTGAAAGTCAATGG + Intergenic
957857611 3:85897862-85897884 TGCAGGGACTTTAAACTCAGGGG - Intronic
958015341 3:87933847-87933869 TCCAGGTTTTTGAAAGTCATGGG + Intergenic
958635781 3:96743723-96743745 TCCAGGGCCTTGAAACTATGAGG + Intergenic
960056500 3:113279746-113279768 TCCTGGGCCTTGAAAGGCCATGG + Intronic
960591267 3:119368207-119368229 TCCAGGCCCTAGGAAGTCACAGG - Intronic
960830113 3:121836997-121837019 GCCAGTATCTTGAAAGTCAGAGG + Intronic
962376081 3:134859615-134859637 GCCAGGGTCTTGAAGCTCAGAGG - Intronic
963056159 3:141188086-141188108 AGCAGGACCTTGAGAGTCAGGGG + Intergenic
966365491 3:179182415-179182437 CCCAGCACTTTGAAAGTCAGAGG + Intronic
967389157 3:188938549-188938571 TCCAGGGGGATGGAAGTCAGCGG + Intergenic
967867857 3:194204622-194204644 CACAGGGGCTTGGAAGTCAGGGG - Intergenic
971781641 4:31042878-31042900 TCTAGGGGCTGGAAAGTCAGAGG + Intronic
972152734 4:36114726-36114748 TCCAGGGTCTTGGTAGTCTGTGG + Intronic
977516579 4:98027695-98027717 TCCTAGGCCTTGAAACTCAATGG - Intronic
978657739 4:111085547-111085569 TCAACTGCTTTGAAAGTCAGTGG + Intergenic
983562825 4:169118065-169118087 TCCAGGGCCTTGAAAGTCAGTGG - Intronic
985447387 4:190032130-190032152 TCCAGCACTTTGAAAGGCAGAGG + Intergenic
989489316 5:42032241-42032263 CCCAGGGCCTTGAAAAACATAGG - Intergenic
989697526 5:44220648-44220670 ACCAGGGCCTGGAAAGTCCACGG - Intergenic
994705254 5:103196317-103196339 TACAAGGCCTTATAAGTCAGAGG + Intronic
995563665 5:113410519-113410541 TCCAGGGCTTTGGAAGGCTGAGG + Intronic
997221376 5:132168723-132168745 TGCAGAACCTTGAAAGTCGGGGG - Intergenic
999623470 5:153495527-153495549 TTCAGGGTCTTGTAAGGCAGAGG + Intronic
1003456156 6:6284616-6284638 TCCAGAGCCTTGAAACTGAGTGG + Intronic
1003583084 6:7360193-7360215 TCAAGGGCCTTGAGATTCAGGGG - Intronic
1005392062 6:25343936-25343958 TGCAGAGACCTGAAAGTCAGAGG - Intronic
1009984299 6:70764880-70764902 ACCTGAGCCTGGAAAGTCAGGGG - Intronic
1010166265 6:72918522-72918544 TCCAGGACCTTGAAAATTTGGGG + Intronic
1010884002 6:81215063-81215085 CCCAGGGCCATGAATGGCAGTGG + Intergenic
1013221691 6:108083293-108083315 TCCAGAGCTTTGGAAGGCAGAGG - Intronic
1013236088 6:108198855-108198877 CCCCGGGCCTTGAATGGCAGTGG - Intergenic
1015790075 6:136957657-136957679 GCCAGGGCCAGGAAAGGCAGGGG - Intergenic
1018310579 6:162504124-162504146 TCCAGGGGTTGGAAAGGCAGAGG + Intronic
1018462272 6:164009618-164009640 TCCGGGTCATTGAAAGGCAGTGG - Intergenic
1022494536 7:30844626-30844648 GCCAAGGCCCTGAAGGTCAGAGG + Intronic
1023514125 7:40983588-40983610 CCCAGGCCCTTTAAACTCAGAGG + Intergenic
1024154507 7:46606411-46606433 AAGAGGGCCTTCAAAGTCAGGGG + Intergenic
1024254758 7:47532175-47532197 ACCAGGGCCTTGAATGGCAGCGG + Intronic
1028082889 7:86599884-86599906 TCCAGGTACTGGAAAGTCTGAGG + Intergenic
1030297099 7:107940118-107940140 GCCAAGGCCTTGAAGATCAGTGG - Exonic
1031970083 7:128058421-128058443 TCCAGGTCCCTGAATGGCAGAGG + Intronic
1033183345 7:139202112-139202134 CCCAGGGCTTTGAAAGACTGAGG + Intergenic
1034497011 7:151429064-151429086 TCCAGGTCCTTGGGAGTCACGGG - Intronic
1035078613 7:156198158-156198180 TCCAGGGGCTGGAAATCCAGAGG - Intergenic
1038459534 8:27704193-27704215 TCCAGTGCTTTGAGAGGCAGAGG + Intergenic
1038646313 8:29365336-29365358 TCCAGGGCCCTGAGGGGCAGCGG + Intergenic
1039881932 8:41630547-41630569 CCCAGGCCCTTGAGACTCAGGGG + Intergenic
1044962307 8:97542885-97542907 CCCAGGGCCTTGAATGGCAGTGG + Intergenic
1048067987 8:130990872-130990894 TCCAGCCCCTTAAAAGCCAGAGG - Intronic
1048731809 8:137450323-137450345 TGCATGGCCTTGGGAGTCAGAGG + Intergenic
1049762341 8:144337081-144337103 TCCTGGGCTTTAAAAGCCAGAGG - Intergenic
1049890472 9:65393-65415 TCCAGGGCCTTAAAACTGAAAGG + Intergenic
1051331398 9:16028147-16028169 GCCAGGGACTGGAAAGTCAGCGG + Intronic
1051496312 9:17727548-17727570 TCCTGGGGCAGGAAAGTCAGAGG - Intronic
1053731936 9:41066577-41066599 TCCGGGGCCTTAAAACTGAGAGG + Intergenic
1054696522 9:68365142-68365164 TCCGGGGCCTTAAAACTGAGAGG - Intronic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1054883016 9:70164762-70164784 TCCAGGTACTTGAAAGGCTGAGG - Intronic
1057198413 9:93127701-93127723 TCTAGGGCCTGGCAACTCAGGGG - Intronic
1057373983 9:94501739-94501761 CCCAGAGCTTTGAAAGACAGAGG + Intergenic
1058957035 9:109958856-109958878 TCCAGGGTCTTGAAACCCTGTGG + Intronic
1059718636 9:116936949-116936971 TCTAGGGCCTTGAATATAAGAGG + Intronic
1060808105 9:126591173-126591195 CCCATGGCCTTGCAGGTCAGAGG - Intergenic
1062075948 9:134590072-134590094 TCCAGGCCCTTGAAGCTCACTGG - Intergenic
1186054218 X:5631808-5631830 TCCAGGGGCTTGAAAACCAAAGG + Intergenic
1186082426 X:5947517-5947539 TCCAAGGCGTTCAAAGTCTGAGG + Intronic
1186879985 X:13855319-13855341 AACATGGCCTTAAAAGTCAGGGG - Intronic
1187048562 X:15674429-15674451 TCCAGCCCATTTAAAGTCAGCGG - Intergenic
1189310344 X:40013790-40013812 TCCAGTGCCATGAAAGCCGGAGG + Intergenic
1196754672 X:119147713-119147735 TCCACGGCCTAGAAGGCCAGAGG + Intronic
1198641931 X:138765778-138765800 TGCAGGGCCTTGATAGTCATGGG - Intronic
1201448829 Y:14087903-14087925 TCCTGGGCCCTAAAAGTGAGTGG - Intergenic
1201653094 Y:16313455-16313477 TCCAGCTCTTTGAGAGTCAGAGG - Intergenic