ID: 983564418

View in Genome Browser
Species Human (GRCh38)
Location 4:169134134-169134156
Sequence TATTTCTAGAAGAGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983564418_983564422 -9 Left 983564418 4:169134134-169134156 CCTCCCAGCCTCTTCTAGAAATA 0: 1
1: 0
2: 0
3: 28
4: 358
Right 983564422 4:169134148-169134170 CTAGAAATAACTTCTCCCTGAGG 0: 1
1: 0
2: 2
3: 22
4: 182
983564418_983564426 24 Left 983564418 4:169134134-169134156 CCTCCCAGCCTCTTCTAGAAATA 0: 1
1: 0
2: 0
3: 28
4: 358
Right 983564426 4:169134181-169134203 CCACTGAAAACAGAACAAACTGG 0: 1
1: 0
2: 2
3: 24
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983564418 Original CRISPR TATTTCTAGAAGAGGCTGGG AGG (reversed) Intronic
900457690 1:2785459-2785481 TATTTCTAGGAAGGGCTGAGGGG + Intronic
900735990 1:4299880-4299902 TATTTCTGGAAGAGGGAAGGAGG - Intergenic
901263660 1:7892652-7892674 TATTTTTAGTAGAGGCGGGGAGG + Intergenic
901573358 1:10179966-10179988 TGTGTCTAGCAGAGGGTGGGCGG - Exonic
902139501 1:14341061-14341083 TATTTTTAGTAGAGATTGGGGGG + Intergenic
902156403 1:14490666-14490688 TATTTTTAGCAGAGACGGGGTGG + Intergenic
903251592 1:22057897-22057919 TATTTTTAGTAGAGGTGGGGGGG + Intronic
903832830 1:26184703-26184725 TGTTTCCAGGAGAGGCTGTGTGG - Intronic
904775260 1:32902116-32902138 TATTTTTAGTAGAGACGGGGCGG - Intergenic
905269049 1:36774750-36774772 TGGATCTGGAAGAGGCTGGGTGG + Intergenic
906423429 1:45689078-45689100 TATTTTTAGTAGAGACGGGGGGG + Intronic
906773505 1:48506976-48506998 TATTTCTGGAAGTGTCTGTGAGG + Intergenic
907130751 1:52095086-52095108 TATTTTTAGTAGAGACGGGGGGG + Intergenic
908829944 1:68168768-68168790 TATGTCTGCCAGAGGCTGGGAGG - Intronic
909939992 1:81600314-81600336 TATTTCTAGAAGAATCTCAGTGG + Intronic
910212677 1:84809649-84809671 TATTTTTAGTAGAGACAGGGTGG + Intergenic
911313925 1:96332869-96332891 TATGATTAGCAGAGGCTGGGAGG - Intergenic
911725379 1:101236852-101236874 TTCTTCAGGAAGAGGCTGGGAGG - Intergenic
912836832 1:113004022-113004044 TATTTTTAGTAGAGACGGGGGGG + Intergenic
913064091 1:115233683-115233705 TAGATCTAGAGGAGGCTGGCAGG + Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914017612 1:143834741-143834763 TCTTTATAAAAGAGGCTGGAGGG - Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914426387 1:147581005-147581027 GATTTGAAGAAGAGGCAGGGAGG - Intronic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914656222 1:149743273-149743295 TCTTTATAAAAGAGGCTGGAGGG - Intergenic
915840612 1:159209770-159209792 TATTTTTAGTAGAGACGGGGGGG + Intergenic
916292102 1:163178131-163178153 TATTTTTAGAAGAGACGGCGGGG - Intronic
916345632 1:163788168-163788190 TATTGCTATAAGAGCCTGAGAGG - Intergenic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
916988821 1:170220121-170220143 TGTTTCTCCAAGAGCCTGGGAGG - Intergenic
917853431 1:179083566-179083588 TATTTTTAGTAGAGGCGGGGGGG + Intronic
917877157 1:179296138-179296160 TATTTTTAGTAGAGACAGGGAGG + Intronic
917887166 1:179398235-179398257 TATTTCTGGAAGATTCTAGGGGG + Intronic
918113567 1:181478899-181478921 CTTTTCCAGAAGAGGCTGGAGGG + Intronic
919285863 1:195558786-195558808 TATAGCTAAAGGAGGCTGGGAGG + Intergenic
920795872 1:209135861-209135883 TATCTATAGAAGAGGCTTGTTGG + Intergenic
921586700 1:216955207-216955229 TATGGTTATAAGAGGCTGGGAGG - Intronic
922189697 1:223307155-223307177 TTTTTCAAGAAGAGACTGGCTGG - Intronic
922230397 1:223680621-223680643 TATTTTTAGTAGAGATTGGGGGG + Intergenic
922916706 1:229263812-229263834 TATTTTTAGTAGAGGTTGGGGGG + Intergenic
922955156 1:229593535-229593557 TGTTTCTGGAAGTGGGTGGGTGG - Exonic
1063466664 10:6250390-6250412 TATTTTTAGTAGAGACAGGGAGG - Intergenic
1063507300 10:6611810-6611832 TGTTTCAAGAAGAGGATGTGTGG + Intergenic
1063908837 10:10809043-10809065 TATTTGGAGATGAGGCTGTGGGG + Intergenic
1065715258 10:28560640-28560662 AATTTCTTTAAGAGTCTGGGTGG - Intronic
1065742707 10:28811659-28811681 TATTTGTAGTAGAGACGGGGGGG + Intergenic
1065875197 10:29991779-29991801 TATTTCTGGATGTGGCTGCGAGG - Intergenic
1068777228 10:60881064-60881086 TATCACTAGAATAGTCTGGGGGG - Intronic
1069671357 10:70207377-70207399 TATTTCTAGACTAGGCATGGTGG + Intronic
1069855551 10:71439067-71439089 TATTTCTAAGGGTGGCTGGGAGG - Intronic
1070358863 10:75667694-75667716 TATTTCTAGAATCAGCTGGATGG + Intronic
1070462363 10:76682736-76682758 TATTTCTAGATGTGTCTGTGAGG + Intergenic
1070563354 10:77584528-77584550 TATTTTTAGTAGAGACAGGGAGG + Intronic
1071270866 10:84006164-84006186 TGTCTCTAGAAGTGGATGGGAGG + Intergenic
1071743814 10:88392130-88392152 TATTTGTAGAAAAGACTGAGTGG + Intronic
1072902690 10:99422985-99423007 TATATCTGTAAGATGCTGGGTGG + Intronic
1073034039 10:100550689-100550711 TAGTGCTAGAAGAAGCTGTGGGG + Exonic
1073417722 10:103398194-103398216 TTTTTCTGGAAGAAGGTGGGTGG + Intronic
1076505940 10:130972628-130972650 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1077791496 11:5445635-5445657 TATTTCTAGATAGGGCTTGGAGG - Intronic
1077972621 11:7210994-7211016 TATTTAAAAAAGAGGATGGGAGG - Intergenic
1078253013 11:9633496-9633518 TATTTCAGGAAGAAACTGGGTGG + Intergenic
1079075830 11:17385029-17385051 TATTTCATGATGAGGGTGGGGGG + Intergenic
1079605078 11:22355382-22355404 TAATGGTAGAAGAGGGTGGGGGG - Intronic
1079970834 11:27032716-27032738 TATTTCTAGAAGATTTTAGGGGG - Intergenic
1080565252 11:33503464-33503486 TATTTCTAGAAGTGAATGGCTGG + Intergenic
1081915746 11:46729150-46729172 TATTTTTAGTAGAGACTGGTGGG + Intronic
1083776607 11:64897191-64897213 TATTTTTAGTAGAGACGGGGGGG + Intronic
1084344059 11:68531893-68531915 TAGTCCTAGAAGAGGTTGAGAGG + Intronic
1084863179 11:72035581-72035603 TATTTTTAGTAGAGACGGGGGGG + Intronic
1086054684 11:82632662-82632684 TATTTATACAAGAGGCTCAGTGG - Intergenic
1087383918 11:97445701-97445723 TAATGCTTCAAGAGGCTGGGTGG - Intergenic
1088622115 11:111696123-111696145 TATTTATAGAAGAGGATTAGGGG - Intronic
1088806433 11:113357675-113357697 TATTTCTAGAAGATTTTAGGAGG + Intronic
1091253351 11:134162826-134162848 ACTTTCTAGAAGTGGCTGGAGGG - Intronic
1091857013 12:3748300-3748322 TGTTTCTAGAAGATGCATGGAGG - Intronic
1092612303 12:10185561-10185583 TATTTCTAGAACAGACTCCGAGG - Intronic
1092937391 12:13376800-13376822 TATTTCTAGGTGTGGCTGTGAGG - Intronic
1093240502 12:16665085-16665107 TATTTGTTGAAGAGCTTGGGAGG - Intergenic
1095303864 12:40618127-40618149 TATTTTTAGTAGAGACGGGGCGG + Intergenic
1095693176 12:45113958-45113980 TATTTTTAGTAGAGACTGGGGGG - Intergenic
1097080680 12:56428571-56428593 TATCTCCAGATGAGGCTGTGAGG - Exonic
1097262849 12:57729220-57729242 TATTGGGAGAAGGGGCTGGGTGG + Intronic
1097768100 12:63548456-63548478 TCTATCTAGAAGAAGCAGGGTGG - Intergenic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1098256875 12:68625744-68625766 TATTTTTAGTAGAGACGGGGAGG - Intronic
1099416243 12:82390539-82390561 TATCTCTAGAAGAAGATCGGTGG + Intronic
1100039923 12:90303052-90303074 TATTTCTGGATGAGTCTGTGAGG - Intergenic
1100286866 12:93174952-93174974 TATTTCCAGGAGAAGGTGGGTGG - Intergenic
1102476167 12:113190154-113190176 TATTTTTAGTAGAGACGGGGGGG - Intronic
1102850600 12:116240711-116240733 TATTTTTAGTAGAGACGGGGGGG + Intronic
1105788664 13:23774969-23774991 TATTTTTAGTAGAGACAGGGGGG + Intronic
1106511068 13:30413060-30413082 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1106652036 13:31701553-31701575 TAGTTGTAGTAGAGCCTGGGTGG - Intergenic
1107250984 13:38362574-38362596 TATTTTTAGCAGAGACAGGGAGG + Intronic
1111290149 13:86155920-86155942 TGTTTTTAGTAGAGACTGGGTGG - Intergenic
1111294628 13:86262995-86263017 TATTTTTAGTAGAGACCGGGGGG - Intergenic
1111988156 13:95086454-95086476 TAATTCTAGAAGAGTCTGCCGGG - Intronic
1112521322 13:100097846-100097868 TATTTTTTGTAGAGACTGGGCGG - Intronic
1113194930 13:107791782-107791804 TATTTTTAGTAGAGACGGGGGGG - Intronic
1113225469 13:108154565-108154587 TATTAGTAGATAAGGCTGGGAGG + Intergenic
1113260317 13:108554331-108554353 TATTTATAGAAAAGATTGGGAGG - Intergenic
1113448813 13:110391136-110391158 TGTTTCTAGAAGAGTCTTGTTGG + Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1115863173 14:37712341-37712363 TATTTCTAAGATAGGTTGGGAGG - Intronic
1117990961 14:61433029-61433051 TTTTTTTTGAAGAGGTTGGGGGG - Intronic
1118208763 14:63747596-63747618 TATTTTTAGGAGAGACGGGGGGG + Intergenic
1118466108 14:66032612-66032634 TATTTCTAAAAGAGGGTTTGGGG - Intergenic
1118715597 14:68557627-68557649 TACTCCTAGAAGGGGCTGGTAGG + Intronic
1122768781 14:104087845-104087867 CATTTCTGAAAGAGGCTGTGAGG + Intronic
1123960753 15:25397435-25397457 TCTTTCTGGAAGAGGTTAGGAGG - Intronic
1125665943 15:41430368-41430390 TATTTTTAGTAGAGACAGGGTGG + Intronic
1126920086 15:53511514-53511536 TATTTCTATAAGGGGGTTGGGGG + Intergenic
1127793688 15:62420568-62420590 TATTTTTAGTAGAGACTGTGTGG + Intronic
1129860948 15:78860926-78860948 TATTTTTAGTAGAGACGGGGTGG - Intronic
1130559024 15:84944460-84944482 TATTAATAGAAGAGGAAGGGAGG + Intronic
1132329008 15:100998004-100998026 TATTTTTAGTAGAGACGGGGGGG - Intronic
1132552950 16:560778-560800 GACTTCGAGAAGAGGGTGGGGGG - Intronic
1133809183 16:9148076-9148098 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1134369950 16:13613918-13613940 TATTTCTGGATGTGTCTGGGAGG - Intergenic
1134532756 16:14997362-14997384 TATTTTTAGTAGAGACGGGGGGG - Intronic
1135261339 16:20983558-20983580 TATTTATAGAAGTTGCTGTGAGG + Intronic
1135379959 16:21987598-21987620 TATTTCAAGAAGAGAGTGGGTGG + Intronic
1135796317 16:25446233-25446255 TGTTTCTTGAAGAGGCGGCGGGG - Intergenic
1136319777 16:29476435-29476457 TATTTTTAGTAGAGGCGGGCTGG - Intergenic
1136434348 16:30215776-30215798 TATTTTTAGTAGAGGCGGGCTGG - Intergenic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1137024670 16:35460690-35460712 TTTTTGTAGAAAAGGTTGGGGGG - Intergenic
1137739951 16:50759063-50759085 TATTTTTAGTAGAGACGGGGGGG - Intronic
1138685386 16:58720752-58720774 TATTTTTAGTAGAGACGGGGGGG + Intronic
1138720054 16:59069391-59069413 TATTTCTAGATGTGTCTGTGAGG - Intergenic
1141583697 16:85018761-85018783 TATTTCAAGTAGATGCTGGCAGG + Intergenic
1142587220 17:980804-980826 TATTTTTAGTAGAGGCGGGGGGG - Intergenic
1142820642 17:2463952-2463974 TATTTCTAGTAGAGACAAGGGGG - Intronic
1143219334 17:5248450-5248472 TATTTTTAGTAGAGACAGGGAGG + Intergenic
1143306777 17:5953712-5953734 TATTTTTAGTAGAGACAGGGTGG - Intronic
1143835152 17:9685971-9685993 TGGTTCTACTAGAGGCTGGGAGG - Intronic
1144336858 17:14279188-14279210 TAGTTCTGGAAGAGGCCTGGGGG - Intergenic
1146033608 17:29387786-29387808 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147699089 17:42380558-42380580 TATTTTTAGTAGAGACGGGGGGG + Intronic
1147812427 17:43182140-43182162 TAGTTCTAGAACAGGCATGGTGG - Intronic
1148034112 17:44645388-44645410 CTTTCCTAGAAGATGCTGGGAGG - Intergenic
1148181964 17:45612698-45612720 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1148266893 17:46233002-46233024 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1148345406 17:46900137-46900159 TATATATAGAAAAGGATGGGAGG - Intergenic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1149036643 17:52141737-52141759 TATATCTAGAAGGGACTTGGTGG + Intronic
1149822892 17:59797160-59797182 TATTTTTAGTAGAGACGGGGGGG - Intronic
1151002428 17:70393165-70393187 TAGTTCTAAAAGAGACTGGTTGG - Intergenic
1151722014 17:75862493-75862515 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1152830676 17:82495393-82495415 TATTTTTTGTAGAGGCCGGGGGG - Intergenic
1153489595 18:5633105-5633127 TTTTTTTGGTAGAGGCTGGGTGG - Intergenic
1153967860 18:10197774-10197796 TTTTTCTAGAAGAAGGTGGAGGG + Intergenic
1156647539 18:39184314-39184336 TATTTTTGGAAAAGGCTGGCTGG + Intergenic
1157880721 18:51318762-51318784 TATTTTTAGTAGAGACTGGGGGG + Intergenic
1158499620 18:57988421-57988443 TATAGCTGGAAGAAGCTGGGAGG - Intergenic
1158921587 18:62197475-62197497 TATTTTTAGACAAGGCTGGGAGG - Intronic
1159324017 18:66892539-66892561 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1159403249 18:67964489-67964511 TATTTCTAGATAGGTCTGGGAGG - Intergenic
1159920801 18:74225924-74225946 TATTTGTTGAAGAGACTGTGGGG + Intergenic
1160095807 18:75871769-75871791 TACATCTGGATGAGGCTGGGCGG - Intergenic
1160212190 18:76890572-76890594 AATTTCTTGAAAAGGCTGTGAGG - Intronic
1160573119 18:79831986-79832008 AATGTCTAGAAAGGGCTGGGTGG + Intergenic
1161045845 19:2134240-2134262 TATTTTTTGTAGAGGCAGGGAGG - Intronic
1161206797 19:3045654-3045676 TATTTTTAGTAGAGACGGGGTGG - Intronic
1161468583 19:4445400-4445422 TATTTCCAGAGGTGGCTTGGAGG + Exonic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1162771729 19:12953403-12953425 TCATCCTAGAAGAGGATGGGGGG - Exonic
1163176953 19:15571051-15571073 TATTTTTAGTAGAGACAGGGGGG + Intergenic
1163270682 19:16251649-16251671 GATTGCCAGAAGAGTCTGGGTGG - Intergenic
1163279424 19:16306535-16306557 TATTTTTAGTAGAGGCGGGGCGG - Intergenic
1163523895 19:17808537-17808559 TTCTTCTAGGAGAGGCTAGGGGG + Intronic
1163817475 19:19475575-19475597 AACTTCCAGGAGAGGCTGGGTGG + Intronic
1164089838 19:21940013-21940035 AACTTCTAGGAGAGGCTCGGTGG + Intronic
1165200397 19:34139014-34139036 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1165220272 19:34310608-34310630 TATTTATCGAGGAGGGTGGGTGG - Intronic
1167845402 19:52159744-52159766 TATGTTTGGAAGAGGCAGGGAGG + Intronic
926054296 2:9765375-9765397 GAGTTTTAGCAGAGGCTGGGTGG + Intergenic
926439711 2:12875193-12875215 TATTTCTAGATGAAGCTAAGTGG + Intergenic
927343606 2:22010504-22010526 TATTTCTTGAAGAAGATTGGAGG - Intergenic
927700021 2:25262012-25262034 TATTTTTAGTAGAGACGGGGTGG - Intronic
927864540 2:26580255-26580277 TGTTTCTAGAAGACGATGGGAGG + Intergenic
927892768 2:26762789-26762811 TATTTCTAGTAGAGATGGGGGGG - Intergenic
928713995 2:34039203-34039225 TATTTCTAGAAGAAGTAGGTGGG - Intergenic
928996537 2:37297888-37297910 TATGTATAGAAAAGGGTGGGGGG - Intronic
930873003 2:56185661-56185683 TTTTCCTAGAAGAGGGTGGCAGG - Intronic
931678701 2:64724600-64724622 TATGACTATAAGTGGCTGGGTGG - Intronic
931983068 2:67714692-67714714 TATTTTTAGTAGAGACGGGGTGG + Intergenic
932721818 2:74144179-74144201 TATTTTTAGTAGAGACGGGGGGG + Intronic
932997813 2:76878696-76878718 TATTTTTAGTAGAGACAGGGTGG - Intronic
936473718 2:112821856-112821878 TGCTCCTAGAAGAGTCTGGGCGG - Intergenic
936936935 2:117847863-117847885 TGATTCCAGAAGAGGCTGTGTGG + Intergenic
940305448 2:152221047-152221069 TATTTCTAGATGTGTCTGTGAGG - Intergenic
940823359 2:158382735-158382757 TATTTTTAGTAGAGACAGGGTGG - Intronic
941714180 2:168746191-168746213 TGTTTCTACAAGGTGCTGGGTGG - Intronic
942083596 2:172424863-172424885 TATTTTTAGTAGAGACGGGGTGG + Intergenic
942672735 2:178393853-178393875 TATTTTGAGAACAGGCTGAGAGG - Intronic
942700507 2:178703229-178703251 GCTTTCTAGAAGAGGCTGGAGGG + Intronic
943715805 2:191151128-191151150 CATTTCTAGAATAGAGTGGGTGG - Exonic
944157008 2:196618150-196618172 TCTTTCTAGAAAAAGCTGGTGGG + Intergenic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
944551250 2:200846536-200846558 TATTTTTAGTAGAGACTGGCTGG + Intergenic
945317656 2:208388137-208388159 TATTTTTAGTAGAGACGGGGGGG - Intronic
945514041 2:210740176-210740198 TGTCTGAAGAAGAGGCTGGGTGG - Intergenic
946686825 2:222279124-222279146 TATTTTTAGTAGAGACGGGGCGG + Intronic
946846115 2:223860444-223860466 TATTTTTAGTAGAGGCGGGGCGG - Intronic
947239447 2:227978300-227978322 TATTTCTAGAACATACTGGTTGG - Intergenic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
947532973 2:230924473-230924495 TGTCTCTTGGAGAGGCTGGGCGG - Intronic
947739283 2:232477753-232477775 TGATTCTAGAAGTGGCTGAGGGG - Intergenic
948344689 2:237285869-237285891 TATTTCTAGGAGTGTCTGTGAGG + Intergenic
1169276718 20:4238074-4238096 TATTTTTAGTAGAGACGGGGGGG - Intronic
1169772781 20:9219646-9219668 TATTTTTAGGAGAGGATGGAGGG - Intronic
1170158897 20:13293020-13293042 TATTTTTAGTAGAGACGGGGGGG - Intronic
1173216594 20:41090676-41090698 TATTTTTAGTAGAGACGGGGGGG + Intronic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1174189729 20:48731792-48731814 TATTCCTAGCAGCAGCTGGGTGG - Intronic
1174425431 20:50428896-50428918 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1174993188 20:55536004-55536026 TATTTCAAGAAGGAGCTTGGTGG - Intergenic
1175713178 20:61237303-61237325 TGCTTCCAGAAGATGCTGGGAGG + Intergenic
1175874758 20:62224126-62224148 TATTTCCAGGAGAGGAGGGGTGG + Intergenic
1176785578 21:13252332-13252354 TATTTTTAGTAGAGACAGGGGGG + Intergenic
1177693494 21:24540819-24540841 TATATCTAGTAGAGTCTTGGTGG - Intergenic
1178978975 21:37245064-37245086 TATTCCTAGACCAGGCTGGCTGG - Intronic
1179245929 21:39634288-39634310 TTTTTCCAGAATAGGGTGGGAGG + Intronic
1181692400 22:24571328-24571350 GCTCTCTACAAGAGGCTGGGAGG - Intronic
1182408206 22:30156879-30156901 TATATCTTGAAGAGGTTTGGAGG - Intronic
1182507699 22:30796679-30796701 TATTTTTAGTAGAGACAGGGGGG + Intronic
1182553338 22:31114334-31114356 TATTTTTAGTAGAGACGGGGGGG - Intronic
1183044699 22:35210590-35210612 TTTGTCAAGAAGAGCCTGGGGGG + Intergenic
1185027120 22:48421130-48421152 TATTTTTAGTAGAGACTGGATGG - Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185253797 22:49820479-49820501 TATTCCCAGCTGAGGCTGGGAGG + Intronic
949193921 3:1283147-1283169 TATTTTTAGTAGAGACAGGGTGG + Intronic
949832937 3:8235968-8235990 TATTTTTAGTAGAGGCGGGGTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951775435 3:26304960-26304982 TATTTTTAGTAGAGGTGGGGTGG + Intergenic
954093918 3:48307542-48307564 TAATTCCAGAAGAGGTGGGGGGG - Intronic
954251162 3:49368588-49368610 TTTTTCTAAAAGTGGGTGGGGGG - Intronic
954843538 3:53534204-53534226 TATTTCCAGAAGTGGCGTGGTGG + Intronic
956208968 3:66783652-66783674 TTTTTGAAGAGGAGGCTGGGTGG - Intergenic
956465589 3:69517703-69517725 TTTCTGAAGAAGAGGCTGGGTGG - Intronic
956573088 3:70718948-70718970 AATCTACAGAAGAGGCTGGGAGG + Intergenic
957474172 3:80702746-80702768 TATTTTTAGTAGAGACGGGGGGG + Intergenic
957547223 3:81655364-81655386 AATTTGTAGAAGAGGGTGGAAGG + Intronic
957590113 3:82185881-82185903 CATTTCCACAAGAGGCTGGGTGG - Intergenic
958135435 3:89483535-89483557 AATTTGCAGAAGAGGCTTGGGGG + Intergenic
958777449 3:98503257-98503279 TAGTTCTAAAAGTGGGTGGGAGG + Intronic
959050075 3:101516116-101516138 TCTTTAAAGAAGAGGGTGGGTGG - Intergenic
959439331 3:106357857-106357879 TATTTCTGGAAGATTTTGGGGGG + Intergenic
959734232 3:109639361-109639383 TATATCTAGAAAAGCCTGGCCGG - Intergenic
960504824 3:118479705-118479727 TATTTCTTTAAGGGGGTGGGAGG - Intergenic
961442911 3:126963302-126963324 TATTTCTAAAAGAAGACGGGTGG - Intergenic
963366800 3:144345326-144345348 TCTTTTTAGAAGAGTCGGGGTGG + Intergenic
964234183 3:154506048-154506070 TATTTTTAGTAGAGACGGGGTGG + Intergenic
964925405 3:161950473-161950495 TATCTCTAGAATAGCATGGGGGG + Intergenic
966769442 3:183491283-183491305 TATTTTTAGTAGAGACGGGGCGG + Exonic
968160325 3:196421598-196421620 TATTTTTACTAGAGACTGGGGGG - Intronic
968579176 4:1381846-1381868 TATTTTTAGTAGAGGTGGGGTGG + Intronic
969567836 4:7990371-7990393 TATTTTTAGTAGAGACAGGGAGG + Intronic
970129880 4:12856450-12856472 TATTTCTAGAAGAGATTGTCTGG + Intergenic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
972047911 4:34692499-34692521 TATTTCTAGATGTGTCTGTGAGG - Intergenic
972129067 4:35807598-35807620 AATTTATAGAAAATGCTGGGAGG + Intergenic
972874725 4:43344168-43344190 TATTTTTAGTAGAGACGGGGGGG + Intergenic
975839098 4:78455224-78455246 TATTTTTAGTAGAGCCGGGGAGG - Intronic
977559820 4:98520882-98520904 TATTTCCAGAAGAGTTTGTGTGG + Intronic
978833765 4:113121833-113121855 TATTTCTAGGATAGGCTTTGGGG + Intronic
981112558 4:140952520-140952542 TTTCTCTAGAAGAGACTGAGCGG - Intronic
982003772 4:151045630-151045652 CAGTTCTAGACGAGCCTGGGTGG + Intergenic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
985922355 5:2987458-2987480 TATTTCTAGGTGTGCCTGGGAGG + Intergenic
986726667 5:10603140-10603162 TCTTTCTAGAAAAGGATGGGAGG + Intronic
986884463 5:12216416-12216438 TATTTTTAGTAGAGACGGGGTGG - Intergenic
988391647 5:30641915-30641937 TATTTCTGGAGGAGTCTGAGAGG + Intergenic
988410657 5:30881512-30881534 TATTTCTGGGTGAGTCTGGGAGG - Intergenic
988889241 5:35596856-35596878 AATTATTAGAAGAAGCTGGGAGG + Intergenic
990781469 5:59369448-59369470 TATTTGGAGAAGAGGCAGGAAGG + Intronic
991245134 5:64502584-64502606 TATTTCTTGCAGGAGCTGGGGGG - Intergenic
991337531 5:65565628-65565650 TATTTTTAGTAGAGACTGGCGGG - Intronic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
994666101 5:102707473-102707495 TTTTTCTATAAAAGGCTTGGGGG + Intergenic
994701783 5:103142595-103142617 TATTTTTAGTAGAGACTGAGAGG - Intronic
994832110 5:104797288-104797310 TAGCTCCAGAGGAGGCTGGGAGG + Intergenic
995283864 5:110364634-110364656 TATTTTTAGTAGAGACGGGGAGG - Intronic
996885402 5:128347952-128347974 TATTTTTAGTAGAGACGGGGAGG + Intronic
997493837 5:134303672-134303694 TATTTTTAGTAGAGACGGGGGGG - Intronic
1000052102 5:157572261-157572283 TATTTTTACTAGAGACTGGGAGG + Intronic
1000826797 5:166054897-166054919 TATTTTTAGTAGAGGCAGGCTGG + Intergenic
1001604443 5:172949894-172949916 TATTTTTAGTAGAGACAGGGTGG - Intronic
1002545785 5:179944142-179944164 TATTTTTAGTAGAGACGGGGGGG + Intronic
1003059212 6:2849648-2849670 TATTTTTAGTAGAGACGGGGTGG - Intergenic
1003339784 6:5208736-5208758 AATTTCTAGAAAAAGCAGGGAGG + Intronic
1003477177 6:6494408-6494430 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1004623936 6:17357269-17357291 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1005377982 6:25203688-25203710 TATTTCTTTAAGAGGATGGATGG + Intergenic
1006100221 6:31681770-31681792 TAATTCTTGAATAGTCTGGGAGG - Intronic
1006540146 6:34733302-34733324 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1007449781 6:41933945-41933967 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1007587998 6:43003909-43003931 TATTTTTAGTAGAGACGGGGTGG + Intronic
1007802724 6:44411178-44411200 TGTGTCTAGAAGTGGGTGGGGGG + Intronic
1008780340 6:55095554-55095576 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1009016512 6:57910223-57910245 TATTTCTATAGGATGCTGTGGGG + Intergenic
1009515191 6:64607204-64607226 TATTTCTAGAATAAGCTAGCAGG + Intronic
1009552734 6:65119970-65119992 TATTTTTAGTAGAGACGGGGAGG - Intronic
1011917156 6:92521393-92521415 TATTGTTAGCAAAGGCTGGGAGG + Intergenic
1013331549 6:109106755-109106777 TATTTTTAGTAGAGACAGGGGGG - Intronic
1013851407 6:114520368-114520390 TATTTCTAGGTGAGTCTGTGAGG - Intergenic
1015176495 6:130314881-130314903 TATTCCTAGAAGCAGCTGGAGGG - Intronic
1015909762 6:138159008-138159030 TATTTTTAGTAGAGGCAGGGGGG + Intergenic
1019807601 7:3139782-3139804 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1019827077 7:3293265-3293287 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1020102138 7:5399864-5399886 TATTTATAGTAGAGACGGGGCGG - Intronic
1023821061 7:43980711-43980733 TATTTTTAGTAGAGATTGGGCGG - Intergenic
1024184802 7:46939252-46939274 TATTTCTAGCAGAATCTGAGAGG - Intergenic
1024925208 7:54605246-54605268 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1027328235 7:77064863-77064885 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1029406895 7:100380791-100380813 TATTTTTAGTAGAGACAGGGAGG - Intronic
1029529974 7:101118867-101118889 TATTTTTTGTAGAGGTTGGGGGG + Intergenic
1029749335 7:102534150-102534172 TATTTTTAGAAGAGATTGGGCGG - Intergenic
1029767278 7:102633254-102633276 TATTTTTAGAAGAGATTGGGCGG - Intronic
1030845107 7:114400030-114400052 TATTTTTAGTAGAGACGGGGGGG + Intronic
1030921425 7:115393527-115393549 ATTTTCTAGAAGAGTCTTGGTGG + Intergenic
1030950485 7:115785159-115785181 TATTTCTACAAAAGGCAGAGGGG + Intergenic
1031413517 7:121468085-121468107 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1031969066 7:128050758-128050780 TGTTTCTGGAAAAGGCTGGCTGG - Intronic
1032125630 7:129190376-129190398 CTTTTCTAGATGAGGCTTGGAGG + Intronic
1032195235 7:129784884-129784906 TCTTTCTGGAGAAGGCTGGGAGG + Intergenic
1032243265 7:130183512-130183534 TAGTTCTAGAAGATGCAGAGTGG + Intronic
1032681463 7:134188697-134188719 TATTCCTAGAGGAATCTGGGAGG - Intronic
1033269782 7:139920378-139920400 CATTTCTAAAAGAGGCAGGAAGG - Intronic
1033814283 7:145053493-145053515 TATCTATAGAAGAGACTTGGTGG - Intergenic
1034191323 7:149215618-149215640 TAGTTCTAGAAGAGCCAGTGTGG + Intronic
1034594764 7:152179643-152179665 AATTTGTTGAAGAGGTTGGGGGG + Intronic
1035264704 7:157684620-157684642 TCTTTCTGGAAGAGGCTGTGTGG - Intronic
1035748893 8:1981550-1981572 TATTTCTGGAAGTGTCTGTGAGG + Intronic
1037339070 8:17823161-17823183 TATTTTCAGTAGAGACTGGGGGG - Intergenic
1038159183 8:25020607-25020629 TATTTTTAGTAGAGGCGGTGGGG - Intergenic
1041067524 8:54096562-54096584 TATTTTTAGTAGAGACGGGGGGG - Intronic
1041508143 8:58624215-58624237 TATTTTTAGTAGAGACAGGGCGG + Intronic
1044556076 8:93563414-93563436 TATTTCTGGATGTGTCTGGGAGG - Intergenic
1044983940 8:97741731-97741753 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1045818685 8:106308407-106308429 TATTTCTAGATGTGTCTGTGTGG - Intronic
1046269777 8:111879765-111879787 TATTTTTAGTAGAGACAGGGAGG + Intergenic
1046672018 8:117066464-117066486 TGTTACTAGAAGAGGTTGGGTGG - Intronic
1048589569 8:135808762-135808784 TCTTCCTAGAAGGGGCTGAGTGG - Intergenic
1049946666 9:603782-603804 TATTTTTAGTAGAGACGGGGTGG - Intronic
1050089669 9:2004921-2004943 TATTTTGAAAAGAGGCTAGGTGG + Intergenic
1051577871 9:18637961-18637983 TATTTCTACAAGTGCCTGTGAGG + Intronic
1052563676 9:30118055-30118077 TATTTCTCTAAATGGCTGGGTGG - Intergenic
1053408229 9:37896493-37896515 TATATTTAAAATAGGCTGGGTGG + Intronic
1053431615 9:38045435-38045457 TATTTTTAGTAGAGACTTGGGGG - Intronic
1055092584 9:72377942-72377964 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1055453360 9:76451254-76451276 TATTGCAAGAAGAGGATGGGTGG + Intronic
1055775084 9:79759211-79759233 TATTTCTAAAAGTGGGTGGTAGG + Intergenic
1055950838 9:81728321-81728343 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1056190537 9:84180232-84180254 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1056969526 9:91190921-91190943 TGTTTGTAAAAGGGGCTGGGGGG - Intergenic
1057603438 9:96479997-96480019 TATTTTTTGTAGAGACTGGGTGG - Intronic
1059325573 9:113502223-113502245 CAGTTCTAGAAGAGGCTCAGGGG - Intronic
1059645889 9:116267043-116267065 TATTTCTATAAGGGGAGGGGTGG + Intronic
1060323234 9:122585653-122585675 TATCACTAGAAAAGGCTGGGTGG + Intergenic
1060522658 9:124302494-124302516 TGGTTCTAGAAGAGGCTGAAGGG - Intronic
1061814540 9:133186522-133186544 TATTTTTAGTAGAGACAGGGGGG - Intergenic
1062149941 9:135012918-135012940 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1062635725 9:137489896-137489918 TATTTCCAGAAGAGGTGGAGGGG + Intronic
1185477580 X:424660-424682 TATTTTTAGCAGAGGCGGGGGGG - Intergenic
1186107064 X:6218950-6218972 TCTTTCTTGAAGAGGCTGCCTGG - Intronic
1186530421 X:10289914-10289936 GCTTTCTGGAAGAGACTGGGTGG - Intergenic
1188502533 X:30843908-30843930 TATTTATAGAAGATGCTGTATGG + Intronic
1188912262 X:35864521-35864543 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1190529093 X:51357014-51357036 TTTTTCTAGGAGTGGCTGTGGGG - Intergenic
1191717112 X:64201246-64201268 TATTTCTAGCAAAGGCAGGCAGG - Intronic
1192256923 X:69469212-69469234 TATTTCAAGAAAAGGCTGAAGGG + Intergenic
1192534558 X:71916219-71916241 TTATTCTAGTAGAGGCTGGTTGG + Intergenic
1194120396 X:89955870-89955892 TATTTCCAGAAGAGGATTGATGG + Intergenic
1196915764 X:120533539-120533561 TATTTTGAGATGAGGTTGGGAGG - Intronic
1196945934 X:120826323-120826345 TATTTTTAGAAGAGGAATGGAGG + Intergenic
1197429058 X:126337176-126337198 TATGTCTAGATGTGGCTGTGTGG - Intergenic
1197829035 X:130621788-130621810 TATTTTTAGTAGAGACGGGGCGG + Intergenic
1199458212 X:148053196-148053218 AACTACTAGAAGAGGCAGGGAGG - Intergenic
1200473260 Y:3613398-3613420 TATTTCCAGAAGAGGATTGTTGG + Intergenic
1201594270 Y:15650479-15650501 CATTTTTTGATGAGGCTGGGAGG - Intergenic