ID: 983564781

View in Genome Browser
Species Human (GRCh38)
Location 4:169138284-169138306
Sequence AAGAGGACCCTACCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983564781_983564784 -7 Left 983564781 4:169138284-169138306 CCATGGAGGGGTAGGGTCCTCTT 0: 1
1: 0
2: 2
3: 12
4: 111
Right 983564784 4:169138300-169138322 TCCTCTTTCCTGCACAGGTTGGG No data
983564781_983564788 7 Left 983564781 4:169138284-169138306 CCATGGAGGGGTAGGGTCCTCTT 0: 1
1: 0
2: 2
3: 12
4: 111
Right 983564788 4:169138314-169138336 CAGGTTGGGTGTAAGGAGCCTGG 0: 1
1: 0
2: 0
3: 18
4: 205
983564781_983564783 -8 Left 983564781 4:169138284-169138306 CCATGGAGGGGTAGGGTCCTCTT 0: 1
1: 0
2: 2
3: 12
4: 111
Right 983564783 4:169138299-169138321 GTCCTCTTTCCTGCACAGGTTGG 0: 1
1: 0
2: 2
3: 18
4: 166
983564781_983564786 0 Left 983564781 4:169138284-169138306 CCATGGAGGGGTAGGGTCCTCTT 0: 1
1: 0
2: 2
3: 12
4: 111
Right 983564786 4:169138307-169138329 TCCTGCACAGGTTGGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983564781 Original CRISPR AAGAGGACCCTACCCCTCCA TGG (reversed) Intronic
900454924 1:2769575-2769597 AACAGCACCCCACACCTCCAGGG + Intronic
900456462 1:2777319-2777341 AACAGCACCCCACACCTCCAGGG + Intronic
901480304 1:9520510-9520532 ACGAGGACACTCCCCCGCCATGG + Intergenic
901883660 1:12208307-12208329 AAGAGGAACCCACCCCTCTGGGG - Exonic
902150840 1:14442064-14442086 AAGATGTCCCTTCCCCTGCAGGG - Intergenic
904730662 1:32588556-32588578 ACCAGGACACTACCCCTTCATGG - Intronic
905242319 1:36588986-36589008 AGGAGGCCCCTACCCTTCAAGGG - Intergenic
905596686 1:39213762-39213784 AGGAGGACCCTTCATCTCCAAGG + Intronic
907520881 1:55022516-55022538 AAGGAGACCCTACCCCTCTCAGG - Intergenic
911025074 1:93427305-93427327 CAGAGGAGGCTCCCCCTCCAAGG + Intergenic
915288188 1:154866072-154866094 AAGTGGTCTCTACTCCTCCATGG - Intronic
916714476 1:167438077-167438099 AAGAGGACCCTACCCTACTGTGG + Intronic
921390097 1:214607536-214607558 ACGAGGACCCCACCTCCCCAGGG + Intronic
922698296 1:227742986-227743008 CACAGGACCCACCCCCTCCAGGG - Intronic
1063771908 10:9213740-9213762 AAAAGGACCCTGCCCCTCCAGGG + Intergenic
1067128479 10:43540581-43540603 ATGAGGGCCCTAACACTCCACGG - Intergenic
1070495494 10:77017662-77017684 AAGAGGACCCTAAGTATCCACGG + Intronic
1071572900 10:86707823-86707845 AGGAGGAGCCTGGCCCTCCAGGG + Intronic
1075618975 10:123911820-123911842 TAGAGCACCCCACCCCTGCAGGG - Intronic
1076407724 10:130224211-130224233 AAGAGGACAGTTCACCTCCATGG - Intergenic
1076872504 10:133200737-133200759 CAGAGGACCCCCCACCTCCAAGG - Intronic
1084119221 11:67059215-67059237 AAGAGGACTCTCCTGCTCCAGGG - Intronic
1087085278 11:94212018-94212040 AGGAGGACCCAAGCTCTCCAAGG + Intergenic
1089651824 11:119919639-119919661 AAGTTGTCCCTAACCCTCCAGGG + Intergenic
1089683690 11:120133605-120133627 AAGTGGGCCCAGCCCCTCCAGGG + Intronic
1090500030 11:127252312-127252334 GAGAGGACCCTACCCCACCTTGG + Intergenic
1091223269 11:133943426-133943448 AAGAGGAGACTCTCCCTCCAGGG + Intronic
1091369141 11:135044335-135044357 AAGAGGACCCTCCCACTCCCTGG + Intergenic
1094844633 12:34356054-34356076 AAGGGGACCCTGCACCTCCCAGG - Intergenic
1096780720 12:53990684-53990706 AAGAGCCCCCCACCCATCCAAGG + Intronic
1104099680 12:125595195-125595217 AATAGGTCCCTCCCCCTTCATGG - Intronic
1104983577 12:132584619-132584641 TGGGGGACCCAACCCCTCCACGG - Exonic
1106029545 13:25987659-25987681 AACATGACCCCACCCCTGCATGG - Intronic
1106817542 13:33425417-33425439 AAGAGCACCCTGGCCCTTCAGGG - Intergenic
1110462262 13:75757971-75757993 AAGAGGAGCCCAACCCTCCCTGG - Intronic
1119971286 14:78973239-78973261 AAGAGGAGCCAACCCCTCCATGG - Intronic
1122262536 14:100531466-100531488 ATGAGGACCCTGCCCCCACATGG - Intergenic
1128790666 15:70431553-70431575 GAGAGGAGCCAACCCCTCCAGGG - Intergenic
1132807139 16:1780026-1780048 GAGAGGAGCCCACCCCTCCCAGG + Intronic
1133033428 16:3022215-3022237 AATAGGTCCCTAACCCCCCAGGG - Exonic
1133162726 16:3922601-3922623 AGGACCACCCAACCCCTCCACGG - Intergenic
1133339459 16:5027260-5027282 CAGAGGTACCTATCCCTCCAAGG - Exonic
1135934318 16:26766734-26766756 AAGAGGACACACCCTCTCCAGGG - Intergenic
1138199843 16:55080518-55080540 AGAAGGACCCATCCCCTCCATGG + Intergenic
1139327356 16:66162856-66162878 AAGAGGACCCCACGCCCTCATGG + Intergenic
1139891284 16:70254608-70254630 AAGCCGCCCCTACCTCTCCAAGG + Exonic
1141020737 16:80493721-80493743 AATGGGACCCCACCCCTCAATGG + Intergenic
1142401916 16:89863389-89863411 CTGAGGACCCTAACCCTCCCTGG - Intronic
1143866337 17:9926466-9926488 CAGAGCACCCCACCCATCCAAGG - Intronic
1146229394 17:31095053-31095075 AAGAGGCCCCCTCCCCTCCCCGG + Exonic
1146511010 17:33448630-33448652 CACAGGACCATATCCCTCCAGGG - Intronic
1147186856 17:38717668-38717690 CAGAGGACCCCAGCCTTCCATGG + Intronic
1148793366 17:50185851-50185873 AAGAAGGCCCTGCTCCTCCAGGG - Exonic
1153344317 18:4009600-4009622 AAGAGAACCCTATCCTGCCATGG - Intronic
1155272436 18:24153605-24153627 AAGAGGAACCAGCCCCTCCAGGG - Intronic
1158220914 18:55149851-55149873 AAGTGTATCCTACCCCTCCTTGG - Intergenic
1158504711 18:58036355-58036377 CAGGGGACCCTACCACTCTAGGG - Intergenic
1160710721 19:549826-549848 CACAGGACCCTTCCCCTCCAGGG + Exonic
1162402081 19:10452786-10452808 ATCAGGACCCATCCCCTCCATGG - Intronic
1164859181 19:31549145-31549167 AAGAGCGCCCTTCCCCTCAAGGG - Intergenic
1165792211 19:38499394-38499416 CACAGGACCCAACACCTCCAGGG - Intronic
1166257834 19:41619011-41619033 AAGAGGACCCTTCCTCTCATTGG - Exonic
1166644448 19:44520566-44520588 AACAGGACCCTAATCATCCATGG - Exonic
1168232595 19:55042694-55042716 AAGAGGAGCGGACCACTCCAGGG - Intronic
933093341 2:78147053-78147075 GAGAGGAGCTTACCACTCCAGGG + Intergenic
937227813 2:120379634-120379656 GGGAGGCCCCTACCCCTCCCAGG - Intergenic
937237175 2:120437874-120437896 AAGGGGACCCTACCCCACACTGG - Intergenic
938579673 2:132634743-132634765 AGGGGGGCCCTTCCCCTCCATGG - Intronic
945680215 2:212904760-212904782 AAGTGGACTCAACACCTCCAGGG + Intergenic
945862692 2:215141754-215141776 CAGAGCACCTTATCCCTCCAAGG + Intergenic
947998325 2:234547207-234547229 AAGACAGCCCTCCCCCTCCAGGG + Intergenic
948694400 2:239725892-239725914 AAGAAGACCCTTCCACACCAGGG - Intergenic
1170174501 20:13453880-13453902 AAGAGGAACCCACCACTGCATGG + Intronic
1170788810 20:19491112-19491134 GTGAGGACCCCTCCCCTCCAAGG - Intronic
1173476563 20:43364001-43364023 AAGAGGAAACTAACACTCCAAGG + Intergenic
1173884522 20:46445716-46445738 AAGAGGAGCTTCCCACTCCAGGG - Intergenic
1174539199 20:51275815-51275837 ACGGGGACTGTACCCCTCCATGG - Intergenic
1178378882 21:32092037-32092059 AAGAGCCTCCTTCCCCTCCAGGG + Intergenic
1180960250 22:19759269-19759291 AAGAGGGCCCTGCACTTCCAGGG + Intronic
1181121244 22:20669681-20669703 ACGAGGACCCCACCTCCCCAGGG + Intergenic
1181334202 22:22116706-22116728 ACGAGGACCCCACCTCCCCAGGG + Intergenic
1183593694 22:38796823-38796845 AAGAGCATCCTCCCCCTCAAAGG - Intergenic
1184277169 22:43415738-43415760 AAGAGGAGCCTACTCATCCCTGG - Intronic
951835562 3:26979739-26979761 AAGTGGCCCCTACCCTTCCATGG - Intergenic
955341941 3:58131661-58131683 AAGAGGAACCTTCTCCTTCATGG + Intronic
956109555 3:65856821-65856843 AACAGGACCTTGCCTCTCCATGG + Intronic
961745875 3:129063169-129063191 ACGAGGACCCCACCCCTTGAGGG + Intergenic
965542097 3:169880536-169880558 AAGAGGAGCCACCCTCTCCAGGG + Intergenic
969556106 4:7911301-7911323 AAGAGGACCCTTCCCCCCTCCGG - Intronic
973989696 4:56391583-56391605 ATGAGAACCCTTCCCCTTCATGG + Intergenic
977894164 4:102345272-102345294 AAGGGGACCCTCCCTCTCCCCGG + Intronic
980750036 4:137076796-137076818 AAGAGGAGCCACCCTCTCCAGGG - Intergenic
983564781 4:169138284-169138306 AAGAGGACCCTACCCCTCCATGG - Intronic
986326550 5:6679662-6679684 AAGAGGATCCTAGCCATCAAGGG + Intergenic
990139596 5:52688401-52688423 AAGTCGATCCCACCCCTCCATGG + Intergenic
997352693 5:133242294-133242316 GATTGGAGCCTACCCCTCCAAGG - Intronic
997400077 5:133595528-133595550 AAGAGGACCCTCCCACTCTGAGG + Intronic
1008302304 6:49856118-49856140 AGTAGAACCCTACCCGTCCAAGG - Intronic
1008477735 6:51950312-51950334 CACAGGTCCCTACCCCGCCAGGG - Intronic
1011536840 6:88384662-88384684 AAGATGATACTACCCCTCCAGGG - Intergenic
1013236012 6:108198508-108198530 GAGAGGAGCCAACCCCTCCAGGG - Intergenic
1013693133 6:112668367-112668389 GAGAGGACCCACCCTCTCCAGGG + Intergenic
1016200045 6:141395303-141395325 AAGAGGAGCTTCCCACTCCAGGG + Intergenic
1016505797 6:144777687-144777709 GAGAGGACTCTCCCCCTCCTCGG - Intronic
1016986581 6:149900118-149900140 ATGAGAACACTACCCCTCCATGG + Intergenic
1017869548 6:158475234-158475256 AGGAGAAGCCTGCCCCTCCATGG + Intronic
1023863555 7:44228581-44228603 AAGGGGCCCAGACCCCTCCACGG - Intronic
1028024630 7:85821614-85821636 GAGAGGACCTTTCCACTCCAGGG + Intergenic
1035053575 7:156018683-156018705 AAGAGGACCCTGACCCTCTAGGG - Intergenic
1035274397 7:157738800-157738822 ATGATGCCCCTACCCCTTCATGG - Intronic
1040577282 8:48664802-48664824 AAGAGTACCCTACTCCCACATGG - Intergenic
1042434894 8:68752416-68752438 AAGATGGCCCTACCCAGCCAGGG - Intronic
1045246445 8:100445501-100445523 CAGAAGACCCCACCCCTCCCTGG - Intergenic
1046909399 8:119609367-119609389 ATGAGGCCCCTACCTCTCCCAGG - Intronic
1048818630 8:138358462-138358484 AAGAGGACCCAAGCCCTCTATGG - Intronic
1049264882 8:141662569-141662591 CAGAGGCCCCTATCCCTCAATGG - Intergenic
1059261592 9:112982295-112982317 AAGAGCACCCTAACCCTGAATGG + Intergenic
1059383913 9:113949549-113949571 AAGAGGAACATTCTCCTCCAGGG - Intronic
1059476365 9:114551088-114551110 ACTGGGACCCTTCCCCTCCATGG + Intergenic
1060279425 9:122206034-122206056 GGTAGGACCCTTCCCCTCCATGG + Intronic
1062103620 9:134740903-134740925 CAGAGGAGCCAACTCCTCCAGGG + Intronic
1186522122 X:10214953-10214975 AGCAGGACTCTACCCCTCCAAGG - Intronic
1189087633 X:38042762-38042784 AAGAAGACCCATCCCCTCAAAGG + Intronic
1192482192 X:71495178-71495200 AAGAGGACACTACAACTGCAGGG - Intronic
1193451126 X:81668970-81668992 AAGAGGACCCAAAACTTCCATGG - Intergenic
1197745066 X:129927144-129927166 AAGACCACCCTTCCCTTCCAGGG + Intronic