ID: 983564786

View in Genome Browser
Species Human (GRCh38)
Location 4:169138307-169138329
Sequence TCCTGCACAGGTTGGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983564781_983564786 0 Left 983564781 4:169138284-169138306 CCATGGAGGGGTAGGGTCCTCTT 0: 1
1: 0
2: 2
3: 12
4: 111
Right 983564786 4:169138307-169138329 TCCTGCACAGGTTGGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983564786 Original CRISPR TCCTGCACAGGTTGGGTGTA AGG Intronic
No off target data available for this crispr