ID: 983565733

View in Genome Browser
Species Human (GRCh38)
Location 4:169149654-169149676
Sequence TTGTGGGTAAGTTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983565733_983565741 29 Left 983565733 4:169149654-169149676 CCCTCTTCCCAACTTACCCACAA 0: 1
1: 0
2: 3
3: 30
4: 320
Right 983565741 4:169149706-169149728 TTTAACTTTTTAATTTTTAAAGG 0: 1
1: 2
2: 42
3: 516
4: 3655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983565733 Original CRISPR TTGTGGGTAAGTTGGGAAGA GGG (reversed) Intronic
901695604 1:11005655-11005677 TGGTGGGTAATTGGGGGAGATGG + Intergenic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903394327 1:22987910-22987932 TTGTGGGTAAATTGTGAGGGAGG - Intergenic
903396399 1:23004817-23004839 TTGTGGGTAAATTGTGAGGGAGG - Intergenic
904663196 1:32100395-32100417 TTGTGGGTGAGCTGGGGATAAGG + Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906959955 1:50414208-50414230 TTGGGAGTAAGTAAGGAAGAGGG - Intergenic
907888668 1:58617642-58617664 ATTTGGGAAAGTTGGGAAGTTGG - Intergenic
908489951 1:64633504-64633526 TTGTTGGGAAGTCAGGAAGAAGG + Intronic
909378221 1:74965291-74965313 ATGTGGGTAAATTGGGAATAAGG - Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910749132 1:90609074-90609096 TTTTTGGTCAGTTGGGGAGATGG - Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
912319016 1:108692892-108692914 TTGGGGGTAAGTTCGGAAGAGGG + Intronic
912462534 1:109845656-109845678 TTGTGGGAAACTTGGCCAGATGG - Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
914674151 1:149895454-149895476 TTCAGGGTAAGTTGGCAAGCTGG + Intronic
915935513 1:160088104-160088126 TTGGGGGTTGGATGGGAAGATGG + Exonic
916052493 1:161046062-161046084 TTGTGGGTTATTTGTGAAGCCGG + Intergenic
916204837 1:162306467-162306489 TTGTGGGAGATTTGGGAAGTGGG - Intronic
917349684 1:174063954-174063976 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918989083 1:191674661-191674683 TGGTGGGTGAGTAGGGATGAGGG - Intergenic
919938884 1:202272905-202272927 TTGTGGCTGAGCTGAGAAGATGG - Intronic
921558674 1:216629997-216630019 TCGTGGGTAATTTGTGGAGAGGG - Intronic
922152397 1:223017371-223017393 TTGTGAGAAAGTAGGGGAGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923849671 1:237780166-237780188 TTGAGGCCAAGTTGAGAAGAGGG + Intronic
924224643 1:241911107-241911129 TTGGGGTTGAGTGGGGAAGAAGG - Intergenic
924411050 1:243806065-243806087 TTTTGGGTGAGAAGGGAAGAAGG - Intronic
924677141 1:246190702-246190724 TTGTGTGTGAGTTGGGGAGGGGG - Intronic
1063164079 10:3443991-3444013 TTGTGGGTAAATTGTGAGGGAGG + Intergenic
1063381072 10:5586516-5586538 TTGTGGGTAAATTGTGAGCAAGG - Intergenic
1065083541 10:22151337-22151359 TTGTGGGCCAGTTTGGAAGAAGG + Intergenic
1065659063 10:27986597-27986619 TTCTGTGTGAGATGGGAAGATGG - Intronic
1068770167 10:60811850-60811872 CTGCGGGAAAGTTGGGGAGAAGG + Intergenic
1068847146 10:61690276-61690298 GAGTGGGTAAGTTAGGAATAAGG - Intronic
1070320056 10:75347852-75347874 TAGTGGTGAATTTGGGAAGAAGG - Intergenic
1070611673 10:77937631-77937653 TTGTGGGGTAGGTGGGAACAAGG - Intergenic
1071129213 10:82371947-82371969 TTGTGGGGGTGTTGGGAGGAGGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1073744534 10:106450811-106450833 TAGAGGGTGAGTTGGAAAGATGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073931266 10:108579417-108579439 TTGTGGGCAAATTGTGAAGGAGG + Intergenic
1073996317 10:109318989-109319011 ATGTGTGTGAGTTGGGGAGAAGG + Intergenic
1074574083 10:114652030-114652052 TCCTGGGAAAGTTGGTAAGAAGG - Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077357691 11:2126327-2126349 TTGTGGGTAAGTGGGTGAGTGGG + Intergenic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078350143 11:10586196-10586218 TTGTGGGTAGGGTGGCAAGTGGG + Intronic
1079087011 11:17453693-17453715 CTGTTGGTAAGTTCGGAACAAGG - Intronic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1079276696 11:19044962-19044984 TTTTGTGTAAGGTGGGAGGAAGG - Intergenic
1079646860 11:22874764-22874786 TTTAGGTTAAGTTGTGAAGAAGG - Intergenic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1082844079 11:57712974-57712996 TTGTGTTTAAGATGGGAAAACGG + Intronic
1083835049 11:65261228-65261250 TTAGGGGTAAGATGAGAAGAGGG - Intergenic
1084303033 11:68263769-68263791 TTGTGGGTGAGCTGGGAGCAAGG + Exonic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1085844271 11:80047977-80047999 TTTTGGGTTGTTTGGGAAGAAGG - Intergenic
1088229710 11:107661264-107661286 TTGTGTGTAAGGTAGGAAAATGG + Intronic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088353193 11:108912688-108912710 TTGTGGGCAAATTGTGAGGAGGG - Intronic
1088804020 11:113334420-113334442 TTGTGGTTTATTTGGGAGGAGGG + Intronic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090549633 11:127806066-127806088 TTGTAGATAAGATGGGGAGATGG - Intergenic
1090735086 11:129605877-129605899 TTGAGGCTAAATAGGGAAGAAGG - Intergenic
1090962206 11:131567054-131567076 TTGGGTGTAAGCTGGGGAGATGG + Intronic
1092786906 12:12034864-12034886 TTGGGGGGCAGTTGGGGAGATGG - Intergenic
1093967712 12:25345023-25345045 TGGGGGGGAAGTAGGGAAGAAGG + Intergenic
1094124623 12:27010801-27010823 TTCTGGGTAAGAATGGAAGATGG - Intronic
1094617812 12:32051987-32052009 TTATGGGAAAGTTTAGAAGAAGG - Intergenic
1094628699 12:32151065-32151087 TGGTGGGGTTGTTGGGAAGATGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1097201893 12:57286118-57286140 TTGTGTGTATGTTGGAGAGATGG + Intronic
1097603415 12:61722998-61723020 TTGTGGAGACATTGGGAAGAAGG - Intronic
1098029769 12:66241836-66241858 TTCTGTGAAAGTTGGGCAGAAGG - Intronic
1098104035 12:67050802-67050824 TTGTGGGTGAGTTGAGGAAAAGG - Intergenic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099257651 12:80334083-80334105 TTGTGGGTAAGGTGTAAGGAGGG + Intronic
1100287574 12:93182208-93182230 TTGAGGGGAAATTGGGTAGAGGG - Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1101616314 12:106341472-106341494 GTGTTGGTGAGTTGGGAAAATGG + Intronic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1102664790 12:114562788-114562810 TTGTGGGAAGTTTGGGAAGGAGG + Intergenic
1104627441 12:130369987-130370009 TTGTGCCTAAGCTGGGAAGCCGG + Intronic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1108962833 13:56257787-56257809 TTGTGGGTGAGTAAAGAAGATGG + Intergenic
1109255790 13:60079946-60079968 GTGTGGGAAAGTTTGGAATAGGG - Intronic
1110150700 13:72249644-72249666 TTGTGGGTGAAATGGGAAAATGG - Intergenic
1112235508 13:97632562-97632584 TTGGGGGTGGGTTGGGGAGAGGG - Intergenic
1112882138 13:104121106-104121128 TTCTGGGTCAGTTGGGAACTTGG - Intergenic
1112996537 13:105581084-105581106 GTTTGGGTAAGTTAGAAAGAAGG - Intergenic
1114242622 14:20882580-20882602 TTATGGGTGATTTGGGGAGAGGG + Intergenic
1114249553 14:20946507-20946529 TTATGGGTGATTTGGGGAGAGGG + Intergenic
1116053935 14:39839754-39839776 ATGTGGGTAAATTGGAAGGATGG + Intergenic
1117604151 14:57408326-57408348 GTGTGTAAAAGTTGGGAAGATGG + Intronic
1122014001 14:98777887-98777909 TTGTGGGGAATGTGGGGAGAGGG + Intergenic
1124474984 15:30025558-30025580 TTGTGGGTAGGTAGGGGAAAGGG - Intergenic
1124914762 15:33959108-33959130 ATGCAGGGAAGTTGGGAAGATGG - Intronic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125526888 15:40382212-40382234 TTGTGGTGAAATTGTGAAGAAGG - Intergenic
1126634358 15:50766581-50766603 GTGTGGGAAAGTAGTGAAGATGG - Intergenic
1128350205 15:66883434-66883456 TTGTGGGGGAGATGGGAGGAGGG - Intergenic
1128394870 15:67214467-67214489 GTGTGGGTAGGTGGGAAAGAGGG + Intronic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128841916 15:70857321-70857343 TTGTGGTGAAGCTGGGAAGTTGG + Intronic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1131008499 15:88998014-88998036 TTGTGGGCAAATTGTGAAGGAGG - Intergenic
1132290495 15:100698877-100698899 TTGGGAGTGAGGTGGGAAGATGG - Intergenic
1132362126 15:101225171-101225193 TTGGAGGTGAGGTGGGAAGATGG - Intronic
1132484825 16:185391-185413 GTGTGGGTTATTTGGGAGGAGGG + Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134787873 16:16961486-16961508 TTGTGGTTAAGCAGGGAAGAGGG - Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1135043213 16:19133875-19133897 TTTTGGGTGAATTGGGGAGATGG + Intronic
1135744425 16:25004011-25004033 TTGTTTGTAAATTGGGAAAAAGG - Intronic
1140692769 16:77500033-77500055 TAGAGGGCAAGTTGGGAAAAAGG + Intergenic
1140833791 16:78774999-78775021 AGGTAGGTAAGTTGGGCAGATGG + Intronic
1141835617 16:86537168-86537190 TTGTGGGAAATTTGGGAAGAAGG + Intronic
1142315845 16:89344517-89344539 TTGTGGGTCATTTTGGCAGATGG - Intronic
1142943329 17:3402230-3402252 TGCTGGGTGAGTTGGGCAGAAGG - Intergenic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1144487823 17:15682286-15682308 TTGTGGGGAAGTTGGGATTTGGG - Intronic
1144706609 17:17372617-17372639 TTGTGGGCAAGTTGTGAGGGAGG - Intergenic
1144913199 17:18700004-18700026 TTGTGGGGAAGTTGGGATTTGGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148757212 17:49979801-49979823 ATGTCGGGAAGTGGGGAAGAGGG - Intergenic
1148819901 17:50354338-50354360 GTGGGGGTGAGATGGGAAGAGGG - Intronic
1149029778 17:52069433-52069455 TTGTGGGTAAGGTCAGAGGAAGG + Intronic
1153115221 18:1646609-1646631 TTGTGGGCAATTTGGAAACAAGG + Intergenic
1153157587 18:2167027-2167049 TTGTTGGTTTGCTGGGAAGAGGG + Intergenic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153364136 18:4235065-4235087 TTGTGGGTAAGCTCAGAAAAGGG - Intronic
1153959155 18:10125489-10125511 TTGTGGTTACCTTGGGAGGAGGG - Intergenic
1154341607 18:13507314-13507336 TCGCGGGGAAGTTGGGAGGAGGG - Intronic
1154390418 18:13931917-13931939 GTGAGGGAAAGTGGGGAAGAGGG - Intergenic
1155569898 18:27181914-27181936 TTGTGGGGAGGTGGGGAAGATGG - Intronic
1155766170 18:29635737-29635759 TACTGGGTAGGTTGAGAAGATGG + Intergenic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1157639679 18:49202035-49202057 TGTTGGGTAAGAAGGGAAGATGG - Intronic
1159023435 18:63161759-63161781 TAGTGCGTCAGGTGGGAAGACGG - Intronic
1164204008 19:23042755-23042777 CTGTGGGCAAATTGTGAAGAAGG + Intergenic
1164416492 19:28050230-28050252 TTGTGGGGTAGCTGGCAAGATGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1166145153 19:40829182-40829204 TTGAGGGTAAGATGGGAGGAGGG - Intronic
1166315579 19:41987808-41987830 TTGTGAGTTAGATGGGAAAAAGG + Intronic
1167406763 19:49315000-49315022 TTGTGGGTAAGTTTGGAGATTGG - Intronic
925637008 2:5950204-5950226 TTATGGGGCAGTTGGGGAGATGG + Intergenic
929368116 2:41186476-41186498 TTGTTGGTATCTTAGGAAGAGGG - Intergenic
929667992 2:43848668-43848690 TTGTGTGTATGTTGGGCAGGGGG - Intronic
929792518 2:45034137-45034159 TTGAGAGGAAGTTGGGGAGAGGG + Intergenic
930101802 2:47609149-47609171 TTCAGGGTAAGGTGGCAAGAGGG - Intergenic
930107208 2:47649786-47649808 TGGTTGGCAAGTTGGGAAGCTGG - Intergenic
930785162 2:55264691-55264713 TAGGGGGTGAGATGGGAAGATGG - Intronic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931460544 2:62446795-62446817 TGGAGGGTAAGGTGGGGAGAGGG + Intergenic
934095626 2:88600880-88600902 GTGTGAGTCAGTTGGGGAGAGGG - Intronic
934993648 2:98938024-98938046 TTGTGAATAGGTTGGGAAAATGG + Intergenic
935233670 2:101120178-101120200 TTGTGGGCAAGATGTGAAGGGGG - Intronic
935571178 2:104661253-104661275 TGGTGGGTAGGTAGGGAAGGGGG + Intergenic
936852874 2:116922432-116922454 TTCTGTGTAATATGGGAAGATGG - Intergenic
939674570 2:145056083-145056105 TTGAGGCTAAGGTGGGCAGATGG + Intergenic
939724204 2:145694911-145694933 TTCTGGGTCAGTTGGGAGAAAGG - Intergenic
940000575 2:148963063-148963085 TTGTGGGTGAGGTGTTAAGAGGG + Intronic
940900159 2:159119342-159119364 AGGTGGGGGAGTTGGGAAGATGG + Intronic
942136555 2:172931618-172931640 TTGTGGTTAACTTTGGAGGAAGG - Intronic
944621147 2:201517173-201517195 TGGTGGGGAGGTGGGGAAGAAGG - Intronic
945212163 2:207394802-207394824 TTATGGGAAAGTTTAGAAGAAGG + Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946768078 2:223058759-223058781 TTGAGGGGAAGATGGGAGGAGGG + Intronic
947134837 2:226966875-226966897 TTGTGGGGAGGTTGGGAGCATGG + Intronic
1170002508 20:11630709-11630731 TTGTGGGTAGGTTGTGAAATGGG + Intergenic
1170703400 20:18724369-18724391 TTGTGTGTGACTTGGGGAGAGGG + Intronic
1171215168 20:23347128-23347150 TGGTGGCTGAGCTGGGAAGAGGG + Intergenic
1171273331 20:23833666-23833688 TTGTGGGCAAATTGTGAGGAAGG - Intergenic
1172640569 20:36437912-36437934 TTGTGGGGATGTGGGGAACAGGG + Intronic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1173265161 20:41472463-41472485 TTATGGGTATGTGGTGAAGAAGG - Intronic
1173622246 20:44445546-44445568 TGGTTGGTACATTGGGAAGAAGG - Intergenic
1174095398 20:48085131-48085153 TTGTGGGTAAATTGTGAGGGAGG - Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175066851 20:56296453-56296475 GGGTGGGTAAGCTGGAAAGATGG - Intergenic
1175477403 20:59286625-59286647 TGGTGGGCAACTTGGTAAGAGGG - Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176524207 21:7853091-7853113 TTGTGAGCAATTTGTGAAGAAGG + Intergenic
1177233600 21:18356219-18356241 ATGTGGGGAATTTGGAAAGACGG + Intronic
1177693848 21:24546089-24546111 TTCTGGTTAAGTTGCCAAGAGGG - Intergenic
1178658227 21:34483104-34483126 TTGTGAGCAATTTGTGAAGAAGG + Intergenic
1179581640 21:42348011-42348033 TTGTGGGCACCTTGGTAAGATGG + Intronic
1183478370 22:38049360-38049382 TTTGGGGGAAGTTGGGAAAAGGG + Intergenic
1183561034 22:38573077-38573099 TTGTGGGTAAGTGGGGAACATGG + Intergenic
1184585353 22:45444244-45444266 TTGTGGGCAAATTGGGAGGGAGG + Intergenic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185267451 22:49911909-49911931 TTGTTGGGCATTTGGGAAGATGG - Intronic
949867072 3:8555124-8555146 TTGTGGGGAAATGGGGCAGAGGG - Intronic
951288450 3:20845194-20845216 TTGAGGCTTAGTTGAGAAGAGGG + Intergenic
951414676 3:22409757-22409779 TTTTGTGTAAGTTGCAAAGAAGG + Intergenic
951549067 3:23858784-23858806 TTGTGAGAAAGTGGGGAGGAGGG - Intronic
952530665 3:34258885-34258907 TGTGGGATAAGTTGGGAAGAAGG + Intergenic
952540378 3:34361063-34361085 TGTTGGGTATGTTGGGCAGATGG + Intergenic
953232854 3:41079933-41079955 TTGTAGGTAAGAGGGGAGGAAGG + Intergenic
955451271 3:59069522-59069544 TTGTTGGGAAGGTTGGAAGAGGG - Intergenic
955490248 3:59474837-59474859 TGGAGGCTGAGTTGGGAAGATGG - Intergenic
955874115 3:63472245-63472267 TCCTGGGCGAGTTGGGAAGAAGG + Intronic
956538319 3:70304822-70304844 TTGTTGGTCAGTTGGGAATCTGG - Intergenic
957448324 3:80344114-80344136 GTTTGGGAAAGTTGGGAAGCAGG - Intergenic
958584209 3:96065160-96065182 TGGTAGGTTAGGTGGGAAGAAGG + Intergenic
961358695 3:126354535-126354557 TCCTGGGTAAGTTGGGAACTGGG - Intronic
962229137 3:133645613-133645635 TTGTTGGTAAGATGGGAAGGAGG + Intronic
964850537 3:161091511-161091533 GTGTGGATACGCTGGGAAGAGGG - Intronic
965074354 3:163957562-163957584 TTGTGAGTAAGTGGGGAAGCAGG - Intergenic
965241721 3:166209428-166209450 TTGTGAATAATTTGTGAAGAAGG - Intergenic
965644621 3:170867404-170867426 TTTTGGGTACGTTGGTAAGTTGG - Intronic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
966958241 3:184907393-184907415 TTGTGGGTAAATTGTGAGGGAGG + Intronic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969367226 4:6703505-6703527 TTGTGGGTAGGTTTGGGGGAAGG - Intergenic
969575972 4:8036023-8036045 GTGTGGGTGAGTGGTGAAGATGG + Intronic
970995390 4:22261633-22261655 TTTTGTGTAAGTTGTGAGGAAGG - Intergenic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
972055151 4:34792707-34792729 TTGTGGGCAAGTTGTGAGGGAGG + Intergenic
974945342 4:68520510-68520532 TTGTGAGTAAATTGGGAAGGAGG - Intergenic
974955274 4:68631928-68631950 TTGTGAGTAAATTGGGAAGGAGG - Intronic
975280389 4:72555468-72555490 CTGTGGATAAGTTGCCAAGAAGG - Intronic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
981039819 4:140212768-140212790 TTGTGGGCAAATTGTGAGGAAGG - Intergenic
982261199 4:153495760-153495782 TTGTGGGTAAATTGTGAGGGAGG + Intronic
982616547 4:157644396-157644418 TGGTGGGCAAACTGGGAAGATGG + Intergenic
982963033 4:161864528-161864550 TAGTGGGAAAGTTGGGAAGCTGG + Intronic
983053148 4:163071690-163071712 TTGAGGCCTAGTTGGGAAGAGGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987575390 5:19721891-19721913 TTGTGATTAAGTTGGGAAGGTGG + Intronic
987635222 5:20530707-20530729 TTTTGTGTAAGTTGTAAAGAAGG - Intronic
988414264 5:30926213-30926235 TTGTGAGGAAGTAGGGAAGAGGG - Intergenic
989185141 5:38616517-38616539 CTGTGGGGAAACTGGGAAGAAGG - Intergenic
989467310 5:41772198-41772220 ATGTGGGTTGGTTGGGGAGAAGG + Intronic
990392812 5:55344308-55344330 GAATTGGTAAGTTGGGAAGATGG + Intronic
991183448 5:63781144-63781166 TTGTGGGTAAACTGTGAAGGTGG + Intergenic
992974720 5:82103051-82103073 TTAGGGATGAGTTGGGAAGATGG - Intronic
993014448 5:82519716-82519738 TTGTGGGGAATGTGGGCAGAGGG + Intergenic
994328319 5:98475550-98475572 TTGTGGGGAGGTTGGGGAGGAGG - Intergenic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
997144313 5:131415861-131415883 TTGTGTGTAAGTTGGTAAGCTGG + Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998081889 5:139282545-139282567 TTATAGAAAAGTTGGGAAGATGG + Intronic
998932195 5:147193758-147193780 TTGTGAGTAATTTGTGAGGAAGG + Intergenic
999285128 5:150390070-150390092 ATGTGGGTAAGTATGGAAGTAGG - Intronic
1001029076 5:168248425-168248447 CTGTGGGGAACTTGGGAGGAAGG + Intronic
1001706663 5:173746019-173746041 TTGTGGGAAAATTGTGAGGAAGG - Intergenic
1003582513 6:7353936-7353958 TTGTGGGGAAGTGTGGAAGGGGG + Intronic
1004421106 6:15470627-15470649 TTGTGGTTTAATTGGGGAGATGG + Intronic
1004507110 6:16255810-16255832 TTGTAAGAAAGTTGGGAGGAAGG + Intronic
1005163411 6:22891890-22891912 TTGTGGAGAAGTTGGAACGAAGG + Intergenic
1005615453 6:27568202-27568224 TTGTGGGCAAATTGTGAGGAAGG - Intergenic
1005755530 6:28922401-28922423 TCTTGAGTAGGTTGGGAAGATGG - Intronic
1006432855 6:34008472-34008494 TTATGGTCAAGTGGGGAAGAGGG - Intergenic
1007532134 6:42552616-42552638 TGGAGGCTAAGGTGGGAAGATGG - Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1008596949 6:53052046-53052068 TTGTGGGGTAGGTGGGACGAGGG - Intronic
1011699915 6:89946446-89946468 TTGTGGGTTAGTTTCAAAGATGG - Intronic
1011703963 6:89982834-89982856 TTGTGCGTAATTTGGAATGAGGG - Intronic
1012064617 6:94534674-94534696 TTGTGGGCAAATTGTGAAGGCGG + Intergenic
1012451481 6:99356706-99356728 TTGAGGCTTAGTTGAGAAGAAGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1016332949 6:142972975-142972997 TGGTGGGGAGGTTGGGAGGAAGG + Intergenic
1016944457 6:149515705-149515727 TAGTGGGTAAGTGAGGAAGCAGG - Intronic
1017108526 6:150910657-150910679 TTGTGGGTAAATTGGGAGCAAGG + Intronic
1018052586 6:160024086-160024108 TTGTGGGTGAGCTGGTAAGCGGG + Intronic
1018320326 6:162601577-162601599 ATGAGAGAAAGTTGGGAAGAGGG - Intronic
1020438913 7:8196614-8196636 TTGTGGGGTGGTTGGGAAGCGGG + Intronic
1021077146 7:16318996-16319018 TTGAGATGAAGTTGGGAAGAAGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1024519462 7:50292060-50292082 AGGTGGATAAGTTGGGAACATGG - Intergenic
1026297468 7:69067359-69067381 GAGCGGGGAAGTTGGGAAGAGGG - Intergenic
1026324964 7:69301070-69301092 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
1031328181 7:120429010-120429032 TTGTCAAGAAGTTGGGAAGAAGG + Intronic
1032538565 7:132684883-132684905 TGGTGGATGAGTGGGGAAGAGGG - Intronic
1034182813 7:149151415-149151437 TAGTGGGTGAGTTGGAAAGATGG + Intronic
1034872465 7:154696296-154696318 TTGAGGCTAAGATGGGCAGAGGG + Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035695937 8:1595741-1595763 TAGTGGTGAATTTGGGAAGAAGG - Intronic
1037899716 8:22680658-22680680 TTGGGGGTAAGTGGGAAGGATGG - Intergenic
1038656709 8:29459407-29459429 TTTTGGGAAAGTGGGGAACATGG + Intergenic
1039149139 8:34483780-34483802 TTGTGGGTCAGGTGTGAAGTGGG - Intergenic
1039275851 8:35933641-35933663 TTGTGGGTAATTGAGCAAGAGGG + Intergenic
1039606306 8:38883685-38883707 ATGTGGGTGAGTTGGTGAGAAGG + Intergenic
1039622563 8:39011972-39011994 ATGTGGGGGAGTTGGGGAGAAGG + Intronic
1039905488 8:41783259-41783281 TTGTGGATAATTTGGGAGGAGGG - Intronic
1040626899 8:49159757-49159779 TTGTGGGAAAGAGGGAAAGAGGG + Intergenic
1041482423 8:58336764-58336786 TTGTGGCTAAGTTTAGCAGAAGG - Intergenic
1041918206 8:63157228-63157250 TTGTGGGAAAGTTGTGAGGGAGG - Intergenic
1042309873 8:67369361-67369383 TTGTGGTTCAGTTAAGAAGAGGG - Intergenic
1045260560 8:100569778-100569800 TTTTGGTTGATTTGGGAAGAGGG - Intergenic
1045298238 8:100890766-100890788 TGAAGGGGAAGTTGGGAAGAGGG + Intergenic
1047439936 8:124868657-124868679 TTGTGTCTAATTGGGGAAGAAGG - Intergenic
1047632722 8:126725817-126725839 TGGTGGGTAACATGGGAAAATGG + Intergenic
1048137079 8:131756968-131756990 ATGTGGGTAAGTTGGGGAGTGGG - Intergenic
1048813183 8:138307012-138307034 GTGAAGGTAAGATGGGAAGATGG - Intronic
1049912960 9:287451-287473 TTCTGGGGAAGATGAGAAGATGG - Intronic
1050008231 9:1157443-1157465 TTGTGGGTAAAATGGGGAGATGG + Intergenic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1050430015 9:5552822-5552844 TTGTGGATAGGTAGGGAAGTGGG - Intronic
1051994924 9:23203453-23203475 ATGTTGGAAATTTGGGAAGATGG - Intergenic
1052065821 9:24018234-24018256 TTTTGTGTAAGATGGAAAGAAGG + Intergenic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1053025557 9:34725750-34725772 TTTGGGGAAAGTGGGGAAGAGGG + Exonic
1053294347 9:36902272-36902294 TTGTCTGTGATTTGGGAAGAAGG - Intronic
1053422592 9:37988981-37989003 TTGTTGGTAAGTTAGTAAGCTGG - Intronic
1054958937 9:70945577-70945599 TTGTGGGAAATTTGGGGAGTTGG - Intronic
1055364732 9:75530574-75530596 TTGGGGGAAAGTTGGGACTAGGG - Intergenic
1056018370 9:82416244-82416266 TTGAGGCCTAGTTGGGAAGAGGG + Intergenic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057636401 9:96773371-96773393 TAGTTGGTAATTTGGGAAGGTGG + Intronic
1058984359 9:110197586-110197608 TTGAGGGTCTCTTGGGAAGATGG - Intronic
1059073072 9:111159985-111160007 TTGTTGTTGAGTTGGCAAGATGG - Intergenic
1060210604 9:121707901-121707923 ATGTGGTGAAGTTGGAAAGAGGG - Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060694640 9:125697821-125697843 TTGGTGGTAAGATGGTAAGATGG - Intronic
1061070515 9:128307334-128307356 TGGAGGGTGAGGTGGGAAGATGG + Intergenic
1186369625 X:8933334-8933356 TTTTGTGTAAGGTGCGAAGAAGG + Intergenic
1186925936 X:14333481-14333503 TTGAGAATAATTTGGGAAGAGGG - Intergenic
1187409640 X:19039065-19039087 TTGTCGGGTAGTTGTGAAGACGG - Intronic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1188909082 X:35823442-35823464 TTGTGGGCAAATTGTGAAGGAGG - Intergenic
1189539760 X:41973549-41973571 TTTTGGACAGGTTGGGAAGAGGG + Intergenic
1189671857 X:43419427-43419449 TTGTGGGTATGTTGGCAAATGGG - Intergenic
1189864969 X:45318286-45318308 TAGTGGGTGAGTTGGGGAGGTGG + Intergenic
1190937947 X:55013469-55013491 TTGTGGGTAAGTTCTCAACATGG - Exonic
1191199219 X:57761270-57761292 TTGTGGACAAGATGGGAACATGG - Intergenic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1193319525 X:80105381-80105403 TTGTGGGCAAATTGTGAGGAAGG - Intergenic
1194883864 X:99288353-99288375 TTGTGGTTACTTTGGGGAGAAGG + Intergenic
1195419453 X:104657443-104657465 TTGTGTATAAGTTGTAAAGAAGG - Intronic
1197376235 X:125685069-125685091 TTGTGGGCAAATTGTGAAAAAGG + Intergenic
1199041998 X:143125377-143125399 TTGTGGGGAAGTTGAGAAAAAGG - Intergenic
1199398435 X:147367843-147367865 TTGTGGGCAAATTGTGAGGAAGG + Intergenic
1199604112 X:149563154-149563176 TTGTGGGGAAGTTGGGATTCTGG - Intergenic