ID: 983566898

View in Genome Browser
Species Human (GRCh38)
Location 4:169162939-169162961
Sequence CTGGGTAAGGAGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 0, 2: 9, 3: 64, 4: 618}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983566898_983566906 8 Left 983566898 4:169162939-169162961 CCCTCCATCCTCTCCTTACCCAG 0: 1
1: 0
2: 9
3: 64
4: 618
Right 983566906 4:169162970-169162992 ATCCAATCCACCATCGCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983566898 Original CRISPR CTGGGTAAGGAGAGGATGGA GGG (reversed) Intronic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
900783973 1:4636190-4636212 CTGGTTATGGAGCAGATGGATGG - Intergenic
901218386 1:7567507-7567529 CAGGGAAAGCAGTGGATGGATGG + Intronic
901258990 1:7857271-7857293 GTGAGTAGGGAGAGGAAGGAGGG - Intergenic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
901769070 1:11521400-11521422 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901769145 1:11521628-11521650 CTGGGAGGGGAGAGGAGGGAAGG + Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
902162538 1:14542944-14542966 TTGGGTATGGAAAAGATGGAAGG + Intergenic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902268593 1:15287072-15287094 ATGGGGAAGGACATGATGGACGG + Intronic
902534302 1:17110297-17110319 GAGGCTAAGGAGAGCATGGATGG + Intronic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903295879 1:22342869-22342891 CTGGGTCAGGTGTGGAGGGAGGG - Intergenic
903830311 1:26170487-26170509 AGGAGTAAGGAGAGGATTGATGG + Intronic
903967481 1:27099755-27099777 CTGAGTAAGGACAGGTTGGGTGG + Exonic
904274173 1:29369579-29369601 CTGGGTATGGAGTGAGTGGAGGG - Intergenic
904325862 1:29727266-29727288 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904325900 1:29727350-29727372 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904325912 1:29727378-29727400 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904325948 1:29727462-29727484 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904325960 1:29727490-29727512 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904325981 1:29727546-29727568 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904326002 1:29727602-29727624 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904326026 1:29727658-29727680 CTGGGGGAGGAGTGGAGGGAAGG + Intergenic
904326052 1:29727742-29727764 CTGAGGGAGGAGAGGAGGGAAGG + Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904433488 1:30479631-30479653 CTGGGGAAGGAGTGGAGGGAAGG - Intergenic
904433513 1:30479687-30479709 CTGGGGGAGGAGTGGAGGGAAGG - Intergenic
904434784 1:30487339-30487361 CTGGGGCAGGACAGGATGGGAGG - Intergenic
904577005 1:31511357-31511379 TTGGGGAGGGAGAGGAGGGAGGG + Intergenic
904586054 1:31581278-31581300 GTGGGTAGGGAGGGGATGGCCGG + Intronic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
905218339 1:36426354-36426376 CTCGGAAAGGAAAGGGTGGAGGG - Intronic
905569451 1:38991816-38991838 CTGGGGGAGGAGAGCCTGGAGGG + Intronic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
905866679 1:41380704-41380726 GTGGGTCAGGAGAGGAGGGCAGG + Intronic
905942930 1:41878720-41878742 GGGGGGAAGGAGAGGAAGGAAGG - Intronic
907190954 1:52648509-52648531 AGGGATAAGGAGAGGAAGGAGGG - Intronic
908163910 1:61438539-61438561 CTGGGTAATGAGAGAATTAATGG - Intronic
908760515 1:67507481-67507503 CTGGGCAATGAGTGCATGGAGGG - Intergenic
910122760 1:83808682-83808704 CTGGCTAAGGAGAGGAGTGAGGG + Intergenic
910806187 1:91191658-91191680 CTGGGAAAGGAGAAGATGAGGGG - Intergenic
911233568 1:95385506-95385528 CTGGCTAGAGATAGGATGGATGG + Intergenic
911306374 1:96237530-96237552 CTAGGTAGGGATAGGGTGGAAGG - Intergenic
911403848 1:97411013-97411035 TTGGGTGAGGAAAGAATGGACGG + Intronic
912058273 1:105632357-105632379 GTGGGTAAGGTGGGGAGGGAAGG - Intergenic
912698572 1:111859380-111859402 GCGGGAAAGGAGAGGTTGGATGG + Intronic
912706594 1:111919544-111919566 ATGGGTTAGGAGAGGAGGCAGGG + Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913283671 1:117208853-117208875 CTGGGTCTGCAGAGGATGGCAGG + Intronic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915461796 1:156075000-156075022 CCGGGCCAAGAGAGGATGGAGGG - Exonic
915489419 1:156242967-156242989 ATGTGTAGGGAGAGGAGGGATGG + Intronic
915564307 1:156705358-156705380 CTGGGTAAGGAAATGTTCGAGGG - Exonic
915604807 1:156943798-156943820 CTGGGTCAGGACAGGAGGAAAGG + Intronic
915642747 1:157241909-157241931 TTGGGTAGGGGGAGGAAGGAGGG - Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916117900 1:161503494-161503516 TTGGGTAAGCAGAGTATAGATGG + Intergenic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
916570012 1:166016980-166017002 CAGGATAAGGGGAGGATGGCAGG - Intergenic
916675634 1:167062605-167062627 CTGGGTGTGGAAAGGATGGTAGG + Intronic
917159823 1:172044969-172044991 ATGAGACAGGAGAGGATGGAAGG + Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
919747132 1:201015857-201015879 CTGGGAGAGGAGAGGCTGGAGGG + Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920252481 1:204630813-204630835 ATGGGTAAGGAGTGGAAGGCAGG - Intronic
920703088 1:208232358-208232380 ATGGGTAAGGAGAGGAGTCAAGG - Intronic
920868813 1:209775767-209775789 CAGGGTATGGGGAGGAGGGATGG + Intronic
922542316 1:226428702-226428724 CTGGGGAGGGAGAGAAAGGATGG - Intergenic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922860563 1:228812221-228812243 CTGGGGACGGATGGGATGGATGG + Intergenic
922905729 1:229172301-229172323 GTGGGTAGGGAGATGATTGAGGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923619582 1:235567459-235567481 TGGGGGAAGGAGAGAATGGAGGG - Intronic
924274827 1:242375122-242375144 CTTGGTAGGGACAGGCTGGATGG - Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924809705 1:247390215-247390237 CAGGTTAAGAAGAGGAAGGAGGG - Intergenic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063578571 10:7284277-7284299 CTGGGCAAGGATGGGGTGGAGGG - Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065046640 10:21752163-21752185 CTGGGGGAGGAGTGGAGGGAGGG - Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065707378 10:28483118-28483140 CTGGGTTGGGAGAGGAGGAAAGG - Intergenic
1066366300 10:34780036-34780058 CGGGGAAAGAAGAAGATGGAGGG - Intronic
1066444049 10:35465593-35465615 GTGGGTAAGGAAAGCATGCAAGG - Intronic
1066661584 10:37741913-37741935 CTGGGTGAGAAGAGGATCCAAGG + Intergenic
1067090009 10:43261711-43261733 CTGGCTGAGGAGAGGAGGGTTGG - Intronic
1068181661 10:53527480-53527502 CTGGGTCTGGAAAGGAAGGAAGG + Intergenic
1068382602 10:56276303-56276325 TGGGGTAGGGAGAGGAGGGAGGG + Intergenic
1069357961 10:67609513-67609535 TTGGGTAAGGGGAGGAGGGTAGG - Intronic
1069547800 10:69341235-69341257 CTGGGGAAGCAGAGGTTGCAGGG - Intronic
1069819793 10:71220343-71220365 GTGGGTAAGAAGGGGAAGGATGG + Intronic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070079180 10:73168456-73168478 CTGGGAAAGGAAAGGAACGAAGG - Intronic
1070314111 10:75294722-75294744 GTGGGGAAGGAGAGGAGGGGCGG + Intergenic
1070462532 10:76684198-76684220 CTGGGCTAGGACAGGAAGGAGGG - Intergenic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1071251473 10:83823959-83823981 CTGGGGAAGGAAGGGAGGGAGGG - Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1072631730 10:97151236-97151258 GTGGGTGAGTAGAAGATGGAAGG + Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073421179 10:103424942-103424964 CTGTGTAAGGAAAGCAGGGATGG + Intronic
1073512939 10:104053670-104053692 ATGGGAAAGGAGAGCCTGGAGGG - Intronic
1073611247 10:104946193-104946215 CTAGATAAGGAGGGGATGTAAGG + Intronic
1073618618 10:105023869-105023891 CTGGATAGGGATAGGATGGTGGG + Intronic
1074355797 10:112781982-112782004 CTAGGAAAGGAGATGCTGGAAGG - Intronic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074724756 10:116296654-116296676 CTGGGTAATAAGAGGATGGCCGG - Intergenic
1074882394 10:117669196-117669218 CTGGGAAAGAAGAGGCTGGGAGG - Intergenic
1074975790 10:118580663-118580685 GAGGGTAAGGAGAGAAGGGAGGG + Intergenic
1075193178 10:120330101-120330123 CTGGGTGAGGAGAGGCTAGCAGG + Intergenic
1075624279 10:123950704-123950726 GTGGGTAGGGAGAGACTGGAGGG - Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075726468 10:124613247-124613269 CTGGGCCTGGAGAGGATGGCCGG - Exonic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076806786 10:132862785-132862807 CAGGTTCAGGAGAGGCTGGAGGG + Intronic
1076867610 10:133175752-133175774 ATGGATTAGTAGAGGATGGACGG + Intronic
1077019102 11:409654-409676 CTGGGGCAGGAGAGGGTGCAGGG + Intronic
1077789636 11:5424511-5424533 CTGTGTACTGGGAGGATGGAGGG - Intronic
1078116099 11:8452537-8452559 TTGGGAAAGGAGAGGCTGGAGGG + Intronic
1078120648 11:8505472-8505494 CTGGGCAAGGGCAGGATGGTAGG - Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079438713 11:20486169-20486191 CTGGGCAAGAAGAGAATGGATGG + Intronic
1080442511 11:32308032-32308054 ATGGGCAAGGAGAGGCTGGCGGG + Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081779969 11:45703438-45703460 CTGGGTAGGGAGAGGATGCCTGG + Intergenic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083215429 11:61215837-61215859 TTGGGACAGGTGAGGATGGATGG - Intergenic
1083218313 11:61234666-61234688 TTGGGACAGGTGAGGATGGATGG - Intergenic
1083433872 11:62629685-62629707 CTGGGTGAGGAGAGAAGAGACGG + Intronic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083729418 11:64644750-64644772 CTGGGTAAGGAAAGGACAGGAGG + Intronic
1084425475 11:69081703-69081725 CTGGGTTGGGAGAGGAAGGCGGG + Intronic
1084465215 11:69319394-69319416 CTGGGCAAGGGGAGGAGAGAAGG - Intronic
1084713121 11:70856490-70856512 ATGGATAATGAGTGGATGGATGG + Intronic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1084941335 11:72614977-72614999 GGGGGTAAGTAGAGGAGGGAGGG - Intronic
1085380447 11:76112409-76112431 CTGGGAAAGGATAGCATGGGAGG - Intronic
1085467877 11:76736550-76736572 CTGCCTAAGGAGAGGATTTAGGG + Intergenic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1086393551 11:86390692-86390714 GTGGGTAGGAAGAGGAAGGAAGG + Intronic
1086969754 11:93067410-93067432 CTGCCTCAGGAGAGGATGGGGGG + Intergenic
1087095591 11:94314459-94314481 CCGGGTAGAAAGAGGATGGAAGG + Intergenic
1087838565 11:102898948-102898970 CTTGGGAAGGTGAGGAGGGAGGG + Intergenic
1088181328 11:107115736-107115758 GTGGGTAAAGAGTGGAAGGAAGG + Intergenic
1088775780 11:113081296-113081318 CTGGCTAACTGGAGGATGGAAGG - Intronic
1088871694 11:113895799-113895821 CTGGGTGAAGAGAGGGTGAACGG - Intergenic
1089303809 11:117514447-117514469 CAGGGAAAGGACAGGCTGGAGGG - Intronic
1089737644 11:120561166-120561188 CTGGGTAAGGAGGGGTGGGGTGG + Intronic
1090173104 11:124622718-124622740 CTGGATGAGGAGAGGAGGGAGGG - Intergenic
1090282226 11:125465925-125465947 CTGGTCAAGGAGGGGAGGGAAGG - Intronic
1090407855 11:126488108-126488130 CTGGGTAAGGAGGGGACTGTGGG + Intronic
1090427152 11:126615921-126615943 CGGGGACAGGACAGGATGGAGGG + Intronic
1090609476 11:128457426-128457448 TCGGGTAAGGTGAGGATAGAAGG - Intergenic
1090936076 11:131343748-131343770 CTGAGTAAAGAGAAGTTGGAAGG + Intergenic
1091218257 11:133916685-133916707 CTGGGAAAGGAGAGGGTCAATGG + Intronic
1091389985 12:120262-120284 CAGAGAAAGGAGTGGATGGAAGG + Intronic
1092203748 12:6603271-6603293 CTGGGCAAGGATAGGTGGGAAGG + Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1094267035 12:28571136-28571158 CTGGGTAAGATGGGGAGGGAGGG + Intronic
1094325170 12:29230325-29230347 CTGGGTAGGGGGAGGAGTGAGGG + Intronic
1095724245 12:45434567-45434589 CTGGGATAGAAGAGGAAGGAGGG + Intronic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096882570 12:54684780-54684802 ATGGGTATGGAGAGGAGGGGAGG + Intergenic
1097191647 12:57222312-57222334 CAGGGTAAGGAGAGGTTCCAGGG - Intronic
1097430580 12:59500176-59500198 CTGGGTGAAGAGAGAATAGAGGG - Intergenic
1097474781 12:60039675-60039697 CTAGGCAAAAAGAGGATGGATGG + Intergenic
1098088761 12:66878460-66878482 CTGGGAGAGGAGAAAATGGAGGG + Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1100270368 12:93018870-93018892 CTGCCTAAGGACAGGATGGGTGG - Intergenic
1101165010 12:102020338-102020360 CTAGGTAAGGACAGGATCTAGGG - Intronic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1101652938 12:106694270-106694292 CTGTGGAAGTACAGGATGGAAGG - Intronic
1101752794 12:107596752-107596774 AGGGGTAAGGAGAGTAGGGAGGG - Intronic
1101896892 12:108763702-108763724 TTGGGGAAGGAGATGATGGCAGG + Intergenic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1102219683 12:111186184-111186206 GTGGGAAAGGAGAGAAGGGAAGG - Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102500948 12:113352222-113352244 AGGGGTAAGGAGGGGAGGGAAGG - Intronic
1102649020 12:114423737-114423759 CTGGGTAATGAGAGCTAGGAAGG - Intergenic
1102755198 12:115334170-115334192 CTGGAGAAGGAGAGGAAGCAAGG + Intergenic
1102827893 12:115965709-115965731 CAGGGGAAGAAGAGGATGGCTGG + Intronic
1103403940 12:120661539-120661561 ATGGATAGGTAGAGGATGGATGG - Intronic
1103485868 12:121282252-121282274 GTGGGGAAGGAGGGGCTGGAAGG + Intronic
1104433072 12:128732524-128732546 CGGGGTGAGAAGAGGAAGGAGGG + Intergenic
1104529910 12:129559966-129559988 CAGGGTAAGGAGGGTTTGGATGG + Intronic
1104778459 12:131404863-131404885 ATGGGTGAGGGGTGGATGGATGG - Intergenic
1105546615 13:21355449-21355471 CTGGGGAGGGGGAGGAGGGAAGG + Intergenic
1106020889 13:25914552-25914574 CTGGTGAAGGAGAGGAGGGATGG - Intronic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106401669 13:29437020-29437042 GTGGGGAAGGAGTGGCTGGAAGG - Intronic
1106563185 13:30863995-30864017 CTGGCAAAGGAAAGGAGGGAGGG - Intergenic
1106971647 13:35147655-35147677 CTGGGTCAGGAGGTGAGGGAAGG + Intronic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107322647 13:39205820-39205842 ATGGGGAAGGAGAGGATGCAGGG - Intergenic
1107596921 13:41972937-41972959 CTGGGTACAGAGAGGATGTTTGG + Intergenic
1108233932 13:48381836-48381858 TGGGGTAGGGAGAGGAGGGAGGG - Intronic
1108573624 13:51772674-51772696 CTGGGAAAGGGGAGGATTTAAGG - Intronic
1108701075 13:52944643-52944665 CTGGGTAAGGAGAGCAAGGAGGG + Intergenic
1110590048 13:77245930-77245952 CTGTGAAAGGAGAGAATGGGAGG - Intronic
1110702297 13:78562841-78562863 CTGAATAAATAGAGGATGGATGG + Intergenic
1112154578 13:96803486-96803508 CTGGGTACGGTGAGGATTAATGG - Intronic
1112251135 13:97781722-97781744 CTGGGTCAGGGGAGGATGGAAGG + Intergenic
1112787975 13:102972299-102972321 CTCAGAAAGGAGAGGATGGGAGG - Intergenic
1113754778 13:112803810-112803832 GAGGGGAAGGAGAGGAAGGAGGG - Intronic
1114054434 14:18954596-18954618 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1114108120 14:19447336-19447358 CAGGGGAAGGAGGAGATGGAAGG + Intergenic
1114128533 14:19760620-19760642 ATGGGAAAGTAGTGGATGGACGG - Intronic
1114424536 14:22611193-22611215 CTTGGCAAGGAGTGGATGGGTGG - Exonic
1114551281 14:23534174-23534196 AGGGGCAAGAAGAGGATGGAGGG - Exonic
1115505316 14:34088170-34088192 ATTAGTAAGGAGAAGATGGAAGG + Intronic
1116394405 14:44430500-44430522 ATTGGTAAGGAGTGGATGCAGGG - Intergenic
1117959852 14:61152062-61152084 CTGTGAAAGGACAGGAGGGAAGG + Intergenic
1118921437 14:70153073-70153095 CTGGGACAGGAGAGGAGGAAGGG + Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119264312 14:73255015-73255037 CAGGGTAAGGACAGGAGGGCAGG + Exonic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119621745 14:76136799-76136821 AGGGGGAAGGAGAGGAAGGAAGG - Intergenic
1119866395 14:77978638-77978660 CTGTGAAATGAGAGAATGGATGG + Intergenic
1120028092 14:79608567-79608589 GTTGGTAAGGACAGGAAGGAAGG + Intronic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1121685328 14:95831397-95831419 CTGTCTCAGGAGAGGACGGAGGG - Intergenic
1121820486 14:96961811-96961833 CTGGATATGGAGAGTATTGATGG + Intergenic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122151522 14:99728552-99728574 CTGGAAATGGAGAGGGTGGAGGG - Intergenic
1124037602 15:26070396-26070418 CTGGGAGAGGAGATGACGGATGG + Intergenic
1124092220 15:26616180-26616202 GGGGCCAAGGAGAGGATGGAGGG + Intronic
1125767662 15:42146100-42146122 CTGGGTGTGGAGACGAAGGAAGG - Intronic
1127546181 15:59996083-59996105 ATCGGTAAAAAGAGGATGGATGG + Intergenic
1127788648 15:62378748-62378770 GTGGGAAAGGAGAGGAAAGAAGG + Intergenic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128707875 15:69850835-69850857 AGGGGTGAGGAGAGGATGGGAGG - Intergenic
1130220799 15:82018008-82018030 CTGGGAGAAGAGAGGATGGGTGG + Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1131040922 15:89266102-89266124 CTTGGGAAGCAGAGGCTGGAGGG - Intronic
1131171232 15:90179679-90179701 CTGGGGAAGGAGAGGAAGATAGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131510501 15:93047306-93047328 CTGGGAAAGGAGTGGAAGAAGGG - Intronic
1131602658 15:93865193-93865215 CTGGGTATGGAGTAGATTGATGG + Intergenic
1132203108 15:99968675-99968697 CTGGGGCCGGAGAAGATGGATGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132794071 16:1710002-1710024 CTATGTAAGGAAAGGATGCAAGG + Intronic
1133088999 16:3389208-3389230 CTGGCAAAGGAGGGGAGGGATGG + Intronic
1133225322 16:4337978-4338000 CTGGGTAAGCCTAGGAGGGAAGG - Exonic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133732438 16:8589184-8589206 CCGGGGAGGGTGAGGATGGAGGG - Intronic
1134031008 16:10992281-10992303 CTGGGCAGGGAGGGGATGCAGGG - Intronic
1134862600 16:17574043-17574065 CTGGCAAGGGAGAGGATGGCCGG + Intergenic
1134890762 16:17839773-17839795 CTGAGAAAGAAGAGGAGGGAGGG + Intergenic
1135077902 16:19410190-19410212 CTGGGAAAGGAGGGGAGAGAAGG + Intergenic
1135226119 16:20659686-20659708 CTGGATATGGAAAGGAAGGAAGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135608173 16:23840744-23840766 ATGGGTTGGGAGAGGAAGGATGG + Intronic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1136618154 16:31410944-31410966 GGGGCTAGGGAGAGGATGGAGGG + Intronic
1137366537 16:47864388-47864410 ATTGGAAAGGAGAGGAAGGAAGG + Intergenic
1137593811 16:49710559-49710581 CCGGGGATGGAGAGGATGCAGGG - Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138509975 16:57503102-57503124 CTGGGTAAGGTGAAGACGGAAGG + Intergenic
1139371335 16:66471217-66471239 CTGGTTAAGGAGGGGACTGATGG + Intronic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139665544 16:68452953-68452975 TTGGGTAACTAGGGGATGGATGG + Intergenic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1140204476 16:72922303-72922325 GATGGTTAGGAGAGGATGGAGGG - Intronic
1140859391 16:79005934-79005956 GTGGGTAACCAGAGTATGGATGG - Intronic
1140937795 16:79691034-79691056 TTGGGTAAGAACAGGATAGAGGG - Intergenic
1140972386 16:80025666-80025688 AAGGGTGGGGAGAGGATGGAAGG + Intergenic
1141163731 16:81646323-81646345 GTGGGTGAGTAGATGATGGATGG + Intronic
1141747150 16:85933421-85933443 CTGGATTAGGAGGGGATGGCAGG - Intergenic
1141786110 16:86201880-86201902 CCGGGTGAGGAGAGGCTGGGTGG + Intergenic
1142395477 16:89828988-89829010 CCGGGGAGGGAGAGGAAGGAGGG - Intronic
1142675054 17:1508465-1508487 CCAGTTAAGGAGAGGAAGGAAGG - Intronic
1143363101 17:6387385-6387407 CTGGGTGAGAAGAAGATGAATGG - Intergenic
1144022890 17:11252545-11252567 CTTAGAAAGGAGTGGATGGATGG - Intronic
1144965856 17:19076926-19076948 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1144982112 17:19175256-19175278 CTTGGTCAGGGGAGGATGGTCGG - Intergenic
1144986111 17:19202983-19203005 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1145205316 17:20981708-20981730 GTGGCTGAGGAGAGGATGGCAGG + Intergenic
1146271960 17:31490410-31490432 ATGGGTAAGGAGGGGGTGAAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146587091 17:34091582-34091604 CAGGGAAGGGAGATGATGGATGG + Intronic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147759962 17:42791155-42791177 CTGGGTAAGGAGAGAAAAGAGGG - Intronic
1148186848 17:45650555-45650577 CTGGGGAGGGGGAGGATGGGGGG + Intergenic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1148441159 17:47712171-47712193 CTGGGCAAGTAGGGGATGCATGG + Intergenic
1148550179 17:48545472-48545494 CTGGGGAAGGGGAGAAGGGAAGG - Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150424842 17:65069021-65069043 CTGGGAAAGGAGACTAGGGATGG - Intergenic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152310995 17:79549661-79549683 CTGGGGAAGGAGACAAAGGAAGG + Intergenic
1152322752 17:79617364-79617386 CGAGGGAAGGCGAGGATGGAAGG - Intergenic
1152341726 17:79729373-79729395 CTGGGTTAGGAAAGGCTGGCTGG + Intergenic
1152426547 17:80221275-80221297 CTGGGAGAGTTGAGGATGGAGGG + Intronic
1152620149 17:81359340-81359362 GGGGCTCAGGAGAGGATGGAGGG - Intergenic
1153824401 18:8862316-8862338 CTGGGTGGAGAGAGTATGGAGGG - Intergenic
1155997015 18:32341119-32341141 TGGGGTAAGGGGAGGAGGGAGGG - Intronic
1156663092 18:39371391-39371413 CGGGGTTAGGGGAGGAGGGAGGG + Intergenic
1157091588 18:44643242-44643264 CTGGGGAAGGTGCTGATGGAAGG + Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157307717 18:46529127-46529149 CTGGGCCTGGAGAGGAGGGAAGG + Intronic
1157530689 18:48418212-48418234 CTGAGTATGGAGAGGAGGGAAGG + Intergenic
1157597906 18:48875033-48875055 CTGGGCCAGGAGGAGATGGAGGG + Intergenic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157913727 18:51643711-51643733 CTGGGGAAGGACAGGAAGGAAGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159014198 18:63088408-63088430 CTGGGTAACAGGAGGCTGGAGGG - Intergenic
1160123392 18:76149576-76149598 TTGGCTCAGCAGAGGATGGAAGG - Intergenic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160451453 18:78969222-78969244 GGGGATAAGGAGAGGATTGATGG - Intergenic
1160511884 18:79457468-79457490 CTGAGAAGGGAGAGGAGGGAGGG - Intronic
1160767842 19:816345-816367 CTGGGTAATGAATGGACGGATGG - Intronic
1160767876 19:816466-816488 CTGGGTAATGAATGGATGGATGG - Intronic
1160767901 19:816554-816576 CTGGGTGATGAATGGATGGATGG - Intronic
1160767931 19:816711-816733 CTGGGTAATGAATGGACGGATGG - Intronic
1160978699 19:1806719-1806741 CGGGGGCAGGAGAGGCTGGACGG - Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162799576 19:13103234-13103256 CTGGGTGAGGAGAGGAGGTGGGG - Intergenic
1163112422 19:15169823-15169845 CTGGGGAGGGGCAGGATGGAGGG + Intronic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164426041 19:28142666-28142688 AGGGGAAAGGAGAGGAAGGAAGG + Intergenic
1164937023 19:32223024-32223046 CTGGGAAAGGAAGGGAGGGAGGG + Intergenic
1164980625 19:32611020-32611042 CTGGGCTAGAAGAGGATGGGGGG + Intronic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165395920 19:35563528-35563550 CTGGGAATGGACAGGATGGAGGG + Intronic
1165824220 19:38696472-38696494 CCGGGTAGGGAGAGGAAGGATGG + Intronic
1165833740 19:38742543-38742565 CAGGATTAGGTGAGGATGGAAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166327997 19:42062894-42062916 ATGGGGAAGGAGAGGAGGCAGGG - Intronic
1167793191 19:51692984-51693006 CAGGGGAAGGAGGGGATGCAGGG - Intergenic
1168081960 19:54016508-54016530 CTGGGTGGGGAGAGACTGGAGGG + Intergenic
1168302584 19:55414669-55414691 CTGGGAAAGGGGTGGAGGGAAGG + Intergenic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168512852 19:56987340-56987362 CTGGGTTAGGAGGGGATGAAAGG - Intergenic
925034252 2:673763-673785 GGGGGGAAGGAGAGGAAGGAGGG + Intronic
925121817 2:1424414-1424436 CTGGGTCAGGTCACGATGGAAGG - Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925867847 2:8244663-8244685 CTGGGAAGGGAGAGGTTGGTGGG - Intergenic
925877415 2:8324786-8324808 CTGGATAGTGAGAGGATAGAGGG - Intergenic
925885233 2:8389820-8389842 CTGGCAAAGGAGAGGATGGCTGG + Intergenic
926309722 2:11666788-11666810 ATGAGTGAGGAGAGGAGGGAGGG + Intronic
926443655 2:12918253-12918275 ATGGGAAGGGACAGGATGGATGG - Intergenic
926761526 2:16282694-16282716 GTGGGGATAGAGAGGATGGAGGG + Intergenic
927485958 2:23488517-23488539 CTGGGGAAGGAGAGGCCTGATGG + Intronic
927510907 2:23643075-23643097 CGGGGTAAGAAGAGGAAGGAAGG + Intronic
927886418 2:26721391-26721413 TTGGGGGAGGAGAGGAGGGAGGG - Intronic
929274145 2:40006974-40006996 TAGGGTAAGGAGAGAAGGGAAGG + Intergenic
929751370 2:44717461-44717483 GTGGGAAAGCAGTGGATGGAGGG - Intronic
929769784 2:44881903-44881925 ATGGATAAGGAAAGAATGGAAGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931773398 2:65518662-65518684 GGAGGTAAGGAAAGGATGGAGGG - Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
933121057 2:78539004-78539026 CTGGAGAAGGAAATGATGGAAGG + Intergenic
933297172 2:80503918-80503940 CTGGGTTAGAACTGGATGGAAGG + Intronic
933687884 2:85157805-85157827 CTGGGTAGGGGCAGGATGGAGGG + Intronic
933981090 2:87551478-87551500 TTGGGTGAGTAGGGGATGGAAGG + Intergenic
934655078 2:96113140-96113162 CTGGGTGTAGAGAGAATGGAGGG - Exonic
935044567 2:99468672-99468694 CTGGATAAGGAGAGATTGGCAGG - Intronic
935708387 2:105876313-105876335 CTCGGTAAGGGCAGGATGGGAGG + Intronic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936516604 2:113185219-113185241 CTGGGTGGGAGGAGGATGGAGGG + Intronic
936594945 2:113839009-113839031 CGGGGTAGGGAGAGGATCCAGGG + Intergenic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
939020366 2:136951085-136951107 GTGGGCTAGGAGAGGATGAAGGG + Intronic
939568151 2:143809101-143809123 CTGGGTAAGGAAATGATAAAAGG + Intergenic
939658269 2:144854323-144854345 CTGGGTAAGAAGAGGTTTCAGGG - Intergenic
939729511 2:145764717-145764739 AAGGTTGAGGAGAGGATGGATGG - Intergenic
940765463 2:157785371-157785393 CCGGATTAGGAGACGATGGAAGG - Intronic
941160569 2:162029963-162029985 ATAGATAAGCAGAGGATGGATGG - Intronic
942226992 2:173825741-173825763 CTGGGTGAGGGCAGGATGGAAGG + Intergenic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
944186825 2:196958172-196958194 TTGGCTAAGGAGAAGAAGGAAGG - Intergenic
944926903 2:204474714-204474736 GTGGGGAAGGAGAGCATGGGAGG - Intergenic
945871840 2:215235610-215235632 CTCTGTAAGGAGAGGATACAAGG + Intergenic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946401873 2:219472506-219472528 CTGGGTGAGGAGAGGAGGCACGG + Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
947587031 2:231362629-231362651 GTGAGGAAGAAGAGGATGGAAGG + Intronic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948106838 2:235421374-235421396 CTGGGTAGGGACAGATTGGATGG - Intergenic
948270796 2:236671857-236671879 CTGGGTGACCTGAGGATGGAAGG + Intergenic
948393064 2:237626588-237626610 CTGGGGAAGGATGGGAGGGAGGG - Intergenic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
1168791392 20:578950-578972 TGGGGTAAGGGGAGGAGGGAGGG - Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169310271 20:4532133-4532155 CTTGCAAAGAAGAGGATGGAAGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171953374 20:31440949-31440971 CTGGGCAGGAAGAGGAGGGATGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172919816 20:38472103-38472125 CTGAGAAAGAAGAGGAGGGAGGG - Intergenic
1173907732 20:46641041-46641063 CCGGGTAGGGAGAGCATGGAGGG + Intronic
1174458025 20:50663275-50663297 CTGGGTAAGGTGCTGATGGGAGG - Intronic
1174863833 20:54116463-54116485 CTGGGGAGGGAGAGGTTGTAGGG + Intergenic
1174972244 20:55288791-55288813 CTGGTTAAAGAAAGGATGCAGGG + Intergenic
1175136317 20:56827066-56827088 CTGGGGAGAGAGGGGATGGAGGG - Intergenic
1175353378 20:58342801-58342823 CTGGGTGAGGGGGGAATGGAAGG + Intronic
1175522378 20:59610177-59610199 CTGGGGAAGCAGAGGTTGCATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1179130943 21:38636668-38636690 GTGGGAGAGGAGAGGTTGGATGG - Intronic
1180182456 21:46124084-46124106 GTGGGTGGGTAGAGGATGGACGG + Intronic
1180472905 22:15676972-15676994 CAGGGGAAGGAGGAGATGGAAGG - Intergenic
1180677617 22:17598614-17598636 GTAGGTAAGGAGAGAAGGGAGGG + Intronic
1180832249 22:18912236-18912258 CTGGGGCAGGAAAGGCTGGAGGG - Intronic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1181067593 22:20314106-20314128 CTGGGGCAGGAAAGGCTGGAGGG + Intergenic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181164475 22:20976024-20976046 GAGGGTAAGGAGAGGTTTGAGGG + Intronic
1181427820 22:22855722-22855744 CTGGGTCAGGGGAGTCTGGAGGG + Intronic
1181528317 22:23502381-23502403 ATGGGGGATGAGAGGATGGAGGG - Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181737357 22:24892315-24892337 CTAGGTAAGGAGAGCCAGGATGG - Intronic
1182019214 22:27066818-27066840 CGGGGTCAAGAGAGGCTGGAGGG - Intergenic
1182063998 22:27417540-27417562 CTAGGTAATGACAGGAGGGAAGG - Intergenic
1182198026 22:28539211-28539233 CTCGGCAAGGAGAGGAAGGCGGG + Intronic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1183274587 22:36885658-36885680 ATGGGGAAGGAGAGGAGGGCGGG - Intergenic
1183680350 22:39325017-39325039 CTGGATTAGGAGAGGATGGAAGG + Intergenic
1184389231 22:44193377-44193399 GTAGGGAGGGAGAGGATGGAAGG + Intronic
1184407353 22:44307748-44307770 CTGGGGAAGGAGAGGAAGGAGGG + Intronic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1184946391 22:47807257-47807279 CTGGGTGCTGAGTGGATGGATGG + Intergenic
1203282334 22_KI270734v1_random:137541-137563 CTGGGGCAGGAAAGGCTGGAGGG - Intergenic
949590889 3:5492972-5492994 CTAGGAAGGGAGAGGAGGGAAGG - Intergenic
949777964 3:7653111-7653133 CAGGCTAAGGAGATGCTGGAGGG - Intronic
949960015 3:9304295-9304317 CTGGGGAAAGAAAGGAGGGAGGG - Intronic
950110808 3:10417401-10417423 ATGGGTGAGCTGAGGATGGATGG + Intronic
950444204 3:13026686-13026708 CAGGGAACGGAGAGGATGCAGGG - Intronic
951043022 3:18009179-18009201 CTGGGCAAGTACAGGAAGGAAGG - Intronic
951280625 3:20744738-20744760 ATTGTAAAGGAGAGGATGGAGGG - Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952740700 3:36731524-36731546 CTGAGTTAGGATAGAATGGAAGG - Intronic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
953057445 3:39399344-39399366 ATGGGAAAGGAGAGAAGGGAGGG + Intergenic
953828746 3:46277323-46277345 CTGGGACAAGTGAGGATGGATGG + Intergenic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954279253 3:49564334-49564356 CTGTGTAAGTCCAGGATGGAAGG - Intronic
954331897 3:49895632-49895654 CTGGGCAGAGAGAGGATGTAGGG + Intronic
954402234 3:50325131-50325153 CTGGGTAGGGAAAGAAAGGAGGG - Exonic
955986513 3:64579099-64579121 TTGGGCAAGTAGAGGAAGGAGGG - Intronic
956149193 3:66223351-66223373 ATGGGTAAGGATAGCATGGCAGG + Intronic
957979766 3:87494144-87494166 CTAGGAAAAGAGAGGAAGGAAGG + Intergenic
960087626 3:113607827-113607849 CTGGGATAAGAGAGGATGGGAGG + Intronic
960575280 3:119223127-119223149 CTTGGTAAGGAGGGGAGAGAGGG - Intronic
960650968 3:119949515-119949537 CTGAGTAAGGAGAGAAAGGTGGG + Intronic
960968301 3:123120853-123120875 GTGGGCAGGGAGAGGATGAAGGG - Intronic
961402034 3:126654604-126654626 CGGGGAGAGGAGAGGACGGACGG + Intronic
962417525 3:135196720-135196742 GTGGGAAAGGAGAAGTTGGAGGG - Intronic
962658844 3:137579925-137579947 CTGGGGAAGGAAAGGATTGTTGG + Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
963246407 3:143067703-143067725 AAGGGAAAGGAGAGGAGGGAGGG - Intergenic
963461598 3:145620909-145620931 CTAGGGATGGAGAGGAGGGAGGG + Intergenic
963840455 3:150099619-150099641 AAGGCTGAGGAGAGGATGGAAGG + Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
967788334 3:193521386-193521408 CTGGGAAAGGAGAGTAGGAAAGG + Intronic
968271069 3:197404200-197404222 CCGGGTAAGGAGATGAAGGAAGG + Intergenic
968322977 3:197787946-197787968 CTAGGTAAAGGAAGGATGGAAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968598368 4:1496905-1496927 ATGGATAGGTAGAGGATGGATGG + Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968687654 4:1972306-1972328 CTGGGAAAGGAGAGGCTGTGAGG + Intronic
969030122 4:4205146-4205168 CAGGGGATGGTGAGGATGGAAGG - Intronic
969330990 4:6473294-6473316 CTGGGTTTGGAGGGGAGGGAGGG - Intronic
969564583 4:7970514-7970536 CTGGGGAAGGAGAGAAGGGCAGG + Intronic
970331803 4:14994202-14994224 CAAGGTAAGGAAAGGAAGGAGGG - Intergenic
970487491 4:16539247-16539269 CTGGGTAAAGAGAGGAGAAAAGG + Intronic
971137566 4:23886424-23886446 GTTGGTAAGGGGAGGATGGGGGG + Intronic
973926881 4:55747877-55747899 CTGGGGATGGGGAGTATGGAAGG + Intergenic
974232156 4:59130789-59130811 CTGGGTGAGGATAGTATGGATGG - Intergenic
975278220 4:72527792-72527814 CTGGGTACCAAGAGGAAGGAAGG + Intronic
975860293 4:78670001-78670023 CTGGGAAAGGAGAGTAGGTAGGG - Intergenic
977076165 4:92453219-92453241 CTGGGAAAGGAGGGGAGAGAAGG + Intronic
977904276 4:102457535-102457557 CTGGGTGTGGAGAGATTGGAAGG + Intergenic
978724713 4:111956572-111956594 TTGGGCAAGGAGAGGAATGAGGG - Intergenic
979485945 4:121270506-121270528 CTAGGTAAGGAGAGGACCCAAGG - Intergenic
979728972 4:123998776-123998798 TTGGGTCAGGAGACCATGGATGG + Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982815543 4:159878969-159878991 CAGGTGAAGGAGAGGATTGAGGG - Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984032696 4:174624477-174624499 ATGGGTAAGGGAAGGATGGGAGG + Intergenic
986639713 5:9860369-9860391 CTGGGGAGGGAGATGAGGGAAGG - Intergenic
987148131 5:15012446-15012468 TTGGGGAAGTGGAGGATGGAGGG + Intergenic
988398727 5:30732666-30732688 CTAGGTCAGGAGCGGATAGATGG - Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990186261 5:53213048-53213070 CTGGATATGGAAAGGAAGGAAGG + Intergenic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991153437 5:63399829-63399851 GAAGGAAAGGAGAGGATGGAAGG - Intergenic
991212406 5:64120870-64120892 CTGAGTAAGGTGAAGAGGGAAGG + Intergenic
991404183 5:66285675-66285697 GTGTGTAAGGAGCGGATGGTTGG + Intergenic
991761870 5:69924947-69924969 CTGGGTAGGGCGGGGAGGGAGGG - Intergenic
991785459 5:70193153-70193175 CTGGGTAGGGCGGGGAGGGAGGG + Intergenic
991841098 5:70799996-70800018 CTGGGTAGGGCGGGGAGGGAGGG - Intergenic
991989196 5:72320527-72320549 CTAGGGAAGGAGGGGAGGGATGG + Intronic
992489571 5:77229044-77229066 GAGGGAAAGGAAAGGATGGAAGG + Intronic
992754151 5:79888747-79888769 GTGGGAAAGGAGAGCTTGGAAGG - Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
995688037 5:114792560-114792582 CTGGGCAAGGGCAGGATAGAAGG - Intergenic
996358563 5:122622027-122622049 TTGATTAAGAAGAGGATGGATGG + Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997672758 5:135689963-135689985 CTGGGTAAGGAGAGGAGCAAGGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997875555 5:137543655-137543677 GTGTGTAAGGAGAGGAGGGTAGG + Intronic
998400355 5:141845637-141845659 CTGGGTGGCGATAGGATGGATGG + Intergenic
999159946 5:149487123-149487145 CTGGGGATGGCCAGGATGGAGGG + Intergenic
1000185010 5:158851046-158851068 CTGGGATAAGAGAGGATGGGTGG - Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001491998 5:172162590-172162612 CTGGGTTTGGAGAGGAGGAAGGG - Intronic
1001546626 5:172574463-172574485 GAGGGGAAGGAGAGGAAGGATGG - Intergenic
1001751430 5:174134515-174134537 ATGGATAATGAGTGGATGGATGG - Intronic
1001834737 5:174822481-174822503 CAGAGTAAGGAGAACATGGACGG + Intergenic
1001932132 5:175680692-175680714 ATGGGACAGGAGAGGATGGGAGG + Intronic
1002173957 5:177391081-177391103 GTGGGGTAGGAGAGGCTGGAGGG - Intronic
1002437461 5:179240402-179240424 CTGGGTAAGGGGTGGAGGGAAGG + Intronic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1003599444 6:7503637-7503659 CAAGGCAAGGAAAGGATGGATGG - Intergenic
1003906792 6:10708179-10708201 GGGGGAAAGGAGAGGATGGGGGG - Intronic
1004569701 6:16833325-16833347 TGGGGTGAGGAGAGGTTGGAGGG - Intergenic
1005021223 6:21420868-21420890 TAGGGTGAGGAGAGGAGGGAAGG + Intergenic
1005159203 6:22838567-22838589 ATAGGTCAGAAGAGGATGGACGG + Intergenic
1005246123 6:23887377-23887399 CTGGGGCAGAAGGGGATGGATGG - Intergenic
1006088727 6:31615465-31615487 CAGGGTAAGGAGAGGAAGGGAGG + Intronic
1006091356 6:31630896-31630918 ACGGGAAAGGAGAGGCTGGATGG + Intronic
1006287202 6:33105672-33105694 CTGGTGAATGAGTGGATGGATGG + Intergenic
1006337793 6:33429506-33429528 CTGGGTGTGGAGAGGAAGAAAGG + Intronic
1006410220 6:33869257-33869279 CTGGGTGAGGAGAGGATTAGGGG + Intergenic
1006599447 6:35215762-35215784 CTGTGAAAGGACAGGTTGGAGGG - Intronic
1007249569 6:40486535-40486557 CTGGGTAAGGAATGGGTAGAGGG + Intronic
1007601959 6:43087761-43087783 CAGGGTAAGGAGAGCCTGTAAGG - Intronic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010418270 6:75641102-75641124 GTAGGGGAGGAGAGGATGGAGGG - Intronic
1010682263 6:78810637-78810659 ATGGGTAAAGAGAGGAAGGAAGG - Intergenic
1010768521 6:79803046-79803068 CTGGGTAAGGAAAGGTCAGACGG - Intergenic
1012242411 6:96888540-96888562 TAGGGTGAGGAGAGGAAGGAAGG - Intergenic
1013011295 6:106122810-106122832 CTGGTTAAGGAGTGGGTAGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014002538 6:116380937-116380959 CTGGCTAAGGTGAAGAAGGAAGG - Intronic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1014638624 6:123880510-123880532 CTGGTTAAGGAGAGAATGGATGG + Intronic
1015862630 6:137696707-137696729 TTAGGAAAGTAGAGGATGGATGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017721189 6:157244213-157244235 AGGGGGAAGGAGAGGAGGGAAGG - Intergenic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1019358807 7:594507-594529 CTAGGTAAGGACAGAGTGGAGGG + Intronic
1019914665 7:4125054-4125076 ATGGGTAATGGGTGGATGGATGG + Intronic
1020711946 7:11617837-11617859 TGGGGTAGGGAGAGGAGGGAGGG + Intronic
1021161613 7:17280113-17280135 CTGGGGAATGAGAGAAGGGAAGG + Intergenic
1021209316 7:17826220-17826242 TTGTGTATGGAGGGGATGGAGGG - Intronic
1021670083 7:23026824-23026846 ATGGGGAAGGAGAGGATACATGG + Intergenic
1021791284 7:24208304-24208326 CTGGGTGAGAGGAGGAGGGATGG + Intergenic
1021861286 7:24908483-24908505 CTGGGTAAAGAGGGCATGGTAGG - Intronic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022161641 7:27716812-27716834 CTGGGTAAGGAAAATATGAATGG - Intergenic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1022490378 7:30813058-30813080 CTGGGGAGGGAGACGATGGTGGG + Intronic
1022602258 7:31772443-31772465 CTGAGTAAGGAGTGGCAGGAAGG - Intronic
1022648488 7:32253602-32253624 CTGGGGAAAGAGAGGATTCAGGG + Intronic
1023752818 7:43388198-43388220 CTGGATGTGGAGTGGATGGATGG - Intronic
1025028558 7:55537416-55537438 CTGGGAAAGAAGAGCATGGTGGG - Intronic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1026964566 7:74431024-74431046 GAGGGTTTGGAGAGGATGGATGG - Intergenic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027600139 7:80230259-80230281 CTTGGCAAGTAGAGAATGGAGGG + Intergenic
1028876391 7:95827909-95827931 CTGGGGGTGGAGGGGATGGAAGG + Intronic
1029117482 7:98244747-98244769 CTGGGGAAGGTGGGGAGGGAGGG + Intronic
1029380509 7:100211375-100211397 AAGGGTAAGAAGAGGATGTAAGG - Intronic
1029550486 7:101234761-101234783 CAGGGGAAGGAGAGGATGTGGGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032325090 7:130920450-130920472 CTGGATAAAGACAGAATGGATGG - Intergenic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033576138 7:142686661-142686683 CTTGGCCAGGACAGGATGGAGGG + Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034263759 7:149772140-149772162 GTGGGGGAGGAGAGGAGGGAGGG - Intronic
1034537315 7:151733650-151733672 CTGAGCAGGGAGAGGAGGGATGG - Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035373522 7:158393857-158393879 CTGGGGAGGGAGGTGATGGAAGG - Intronic
1035902240 8:3469727-3469749 CTGCCTAAGGTGAGGATGTAGGG - Intronic
1036462153 8:8962986-8963008 CTGGGCAAAGAGAGGATGCATGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1036567541 8:9950338-9950360 CTGAGTCTGGTGAGGATGGAGGG + Intergenic
1037240643 8:16773395-16773417 CTGGGTAAGGAGGGAAGGGAGGG - Intergenic
1038073138 8:24040291-24040313 CTGGGAGATGAGAGGATAGAAGG - Intergenic
1038670263 8:29577412-29577434 CTGGGCAAGGAGGGGAAAGAAGG - Intergenic
1039153724 8:34531940-34531962 CGGGTTAAGGACAGGAAGGAGGG + Intergenic
1039606601 8:38885730-38885752 TTGGGAAAGGAGAGGTGGGAAGG - Intergenic
1040575500 8:48647920-48647942 CAGGGAAAGGAGATGATGGATGG + Intergenic
1040601447 8:48888374-48888396 GTGAGTCAGGAGAGGATGCAGGG - Intergenic
1040625747 8:49147987-49148009 CTGGGTTGGCAGAGGAGGGACGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044040846 8:87366702-87366724 GTGGGTAAGGAGAGCATGACAGG + Intronic
1044602979 8:94024369-94024391 CTGGGAAAGTGCAGGATGGAGGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045331394 8:101158643-101158665 CTGTGTATGCAGATGATGGATGG + Intergenic
1045402248 8:101831012-101831034 CCAGGTCAGGTGAGGATGGAGGG - Intronic
1047217994 8:122894414-122894436 ATGGCTAAAGAGAGGATGAATGG - Intronic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048370152 8:133770131-133770153 CAGGGTACAGAGAGAATGGATGG - Intergenic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048795034 8:138141764-138141786 CGGGTGAAGGAGAGGATGAATGG - Intronic
1049155280 8:141062486-141062508 CTGGATGGAGAGAGGATGGAAGG + Intergenic
1049321143 8:141997042-141997064 GTGGATAAGGACAGGTTGGAGGG + Intergenic
1049359994 8:142207808-142207830 ATGGGGAATGGGAGGATGGATGG + Intergenic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1050457253 9:5846039-5846061 CTGGGTCTGGAGAGGTTGGGTGG + Intergenic
1050539334 9:6656709-6656731 GTGGGGAAGGAGGGAATGGAGGG + Intergenic
1051596801 9:18832196-18832218 CTGGGGAAGTTCAGGATGGAAGG - Intronic
1051794466 9:20849325-20849347 GGGGGAAAGGAGAGGATAGATGG - Intronic
1052889754 9:33687447-33687469 CTTGGCTAGGACAGGATGGAGGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055824504 9:80307154-80307176 AGGGGAAAGGAGAGGAGGGAGGG - Intergenic
1057426844 9:94958041-94958063 CTGGGGGAGGAAAGAATGGAGGG - Intronic
1059329144 9:113524190-113524212 GGGGGTATGGAGAGGATGGCAGG - Intronic
1060800799 9:126544835-126544857 CTGGGTGAGAAGATTATGGATGG + Intergenic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061293875 9:129666744-129666766 CTTGGTAAGAAGGGGAGGGACGG + Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062246866 9:135573487-135573509 CTGGATATGCAGTGGATGGATGG - Intergenic
1062262988 9:135672091-135672113 CTGGGAAAGGGGAGGAAGCAGGG - Intergenic
1062479018 9:136742963-136742985 CTGTGTCGGGAGAGGAGGGAGGG + Intronic
1185613698 X:1407526-1407548 ATGGGTAGGTAGATGATGGATGG + Intronic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186399220 X:9241417-9241439 CTGCGTAAGAAGAGGATGCAAGG + Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187468849 X:19550715-19550737 CTGTGTAAGGACAGGATGACTGG + Intronic
1187522071 X:20022534-20022556 CTGAGGAAGGAGAGGAGGGACGG + Intronic
1188111905 X:26204405-26204427 CTGCGTAAGGAGACTCTGGAAGG + Intergenic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1189408110 X:40743969-40743991 CTAGGGAAGGCCAGGATGGAAGG - Intergenic
1189958886 X:46306392-46306414 TTGGGTAGGGATAGGATGGCAGG + Intergenic
1191851592 X:65589583-65589605 CTGGGAAGGGAGAGGAAGGCAGG + Intronic
1192582909 X:72299636-72299658 CTAGGAAGGGAGAGGAAGGAGGG - Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1193658811 X:84231658-84231680 GTGGGGAAGGATAGGAAGGAAGG + Intergenic
1195706115 X:107739036-107739058 CTGGGAAAGGAGAGGAAATAAGG + Intronic
1195966365 X:110433430-110433452 CTGGGGTAGGAGAGGATGGGAGG + Intronic
1196031509 X:111098638-111098660 CTGGGTAAGGAGAGGGCAGTGGG + Intronic
1197148298 X:123192490-123192512 CAAGGTAAGGGAAGGATGGAGGG - Intronic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198479347 X:137026891-137026913 CTGGGTTGGGAAGGGATGGATGG + Intergenic
1198771442 X:140135025-140135047 CTTGAAAAGGAGAGGATGGTGGG + Intergenic
1199543523 X:148983696-148983718 TTGGGGAATGATAGGATGGATGG - Intronic
1199764549 X:150931400-150931422 CTGCCTCAGGAGAGGATGAAGGG + Intergenic
1199854614 X:151750204-151750226 CTGGGGAAGGAGAGAATGTCAGG + Intergenic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200311863 X:155086371-155086393 CTGGGCAAGGAAGGGAGGGAGGG - Intronic
1200424726 Y:3008498-3008520 GTGGGTAATGAGAGCAGGGAGGG + Intergenic
1200908551 Y:8510998-8511020 GGAGGGAAGGAGAGGATGGAAGG - Intergenic
1202303875 Y:23447241-23447263 CTGGGCAAGGCGATAATGGAAGG - Intergenic
1202566935 Y:26223350-26223372 CTGGGCAAGGCGATAATGGAAGG + Intergenic