ID: 983571897

View in Genome Browser
Species Human (GRCh38)
Location 4:169217715-169217737
Sequence ATGGATACAGAGTTTTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983571894_983571897 9 Left 983571894 4:169217683-169217705 CCTGGGAGAAGGGAATAGGGAGT 0: 1
1: 0
2: 6
3: 35
4: 364
Right 983571897 4:169217715-169217737 ATGGATACAGAGTTTTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983571897 Original CRISPR ATGGATACAGAGTTTTAGCT GGG Intronic
No off target data available for this crispr