ID: 983576965

View in Genome Browser
Species Human (GRCh38)
Location 4:169270823-169270845
Sequence GGTCCCCGTCGACCCCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983576954_983576965 15 Left 983576954 4:169270785-169270807 CCACCGCCTTCTCCGCGGCTAGG 0: 1
1: 0
2: 1
3: 5
4: 156
Right 983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
983576958_983576965 12 Left 983576958 4:169270788-169270810 CCGCCTTCTCCGCGGCTAGGGGT 0: 1
1: 0
2: 0
3: 4
4: 65
Right 983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
983576960_983576965 3 Left 983576960 4:169270797-169270819 CCGCGGCTAGGGGTCCGCCGACG 0: 1
1: 0
2: 0
3: 4
4: 24
Right 983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 48
983576959_983576965 9 Left 983576959 4:169270791-169270813 CCTTCTCCGCGGCTAGGGGTCCG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983576965 Original CRISPR GGTCCCCGTCGACCCCGCGC CGG Intronic
900172038 1:1273954-1273976 TGTCGCCGTCGACCCCGGGGTGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
909393121 1:75137152-75137174 TGTCCCCGTCGTCCTCGCCCCGG + Exonic
910876781 1:91885790-91885812 GGTGCCCGTCGGCGCGGCGCGGG - Intronic
1063115355 10:3068262-3068284 GGACCCCGCCCACGCCGCGCAGG - Intronic
1064208893 10:13347564-13347586 GGGCCCTGTCGACCCGGGGCGGG - Intronic
1077134920 11:993706-993728 GGACACCGTCGTCCCCTCGCAGG - Intronic
1081700138 11:45147352-45147374 GGACGCCCTCGGCCCCGCGCCGG + Exonic
1083747140 11:64742872-64742894 GGGCCCAGCCCACCCCGCGCCGG - Exonic
1090375164 11:126283160-126283182 GGTCCCCCGCGACCCCGCCCCGG - Intronic
1108541682 13:51452321-51452343 GGTCCCCGACACCCCCGCCCCGG + Intronic
1108668118 13:52652734-52652756 TGTCCCAGCCGGCCCCGCGCCGG + Intronic
1115331608 14:32203691-32203713 GGTGCGCGCCGACCCCGGGCCGG - Intergenic
1121518568 14:94570159-94570181 GGTCCCCGTGGAAGCCGCCCTGG - Intronic
1122221394 14:100240549-100240571 GCTCCCCGCCCACCCAGCGCCGG + Intronic
1122558419 14:102593375-102593397 GGTCCCCGGCGAGCCCGAGGGGG + Intronic
1127293697 15:57591941-57591963 GTCCCGCGTCGCCCCCGCGCAGG + Exonic
1132143748 15:99414838-99414860 GGTGCCCATCGTCCCCGCTCAGG - Intergenic
1132729153 16:1352091-1352113 GCTCCCCGTAGGGCCCGCGCCGG + Exonic
1133995423 16:10744326-10744348 TGTCCCTTTCGACTCCGCGCCGG - Intronic
1142211800 16:88811936-88811958 GGTCCCGCCCGTCCCCGCGCAGG - Exonic
1142868865 17:2807926-2807948 GGTCCCCGGAGACCCTCCGCTGG + Intronic
1143595102 17:7909343-7909365 GGGCCGCGGCGGCCCCGCGCGGG + Intronic
1151597596 17:75087900-75087922 GGTCCCCGCCCACACCGCCCTGG + Intronic
1153855088 18:9137199-9137221 GGGCCCCGGCGGACCCGCGCCGG - Intronic
1160577319 18:79864065-79864087 GCGCTCCGTCGGCCCCGCGCGGG - Exonic
1160878210 19:1307652-1307674 GGTCCAGGTCCACGCCGCGCTGG + Intergenic
1161080021 19:2305986-2306008 AGTCCCCGTCAACCCCTCGAGGG + Intronic
1161407617 19:4099258-4099280 CTTCCCCGTCGACCACGGGCCGG + Exonic
1162019823 19:7863286-7863308 TGTCCCCGGCATCCCCGCGCCGG - Intronic
1163720454 19:18896034-18896056 GGGCCCCGTCGGCCCCGCCGCGG + Exonic
925959792 2:9003856-9003878 CGCCCCCGTCGTCCCCGCCCCGG + Intergenic
926077267 2:9951536-9951558 CGTCCCCGTCAGCCCCGCCCCGG + Intergenic
941905972 2:170716375-170716397 GGTGCCCTACGACCCCGCGCTGG + Exonic
942240876 2:173963973-173963995 GGTCCCCGCCGACTGCGCCCGGG + Intronic
946378943 2:219331708-219331730 GGTCCACGCCGAGCCCGAGCGGG - Intronic
1172483896 20:35287325-35287347 GGTACCCATCGACCCCGCAGGGG + Exonic
1173843583 20:46174517-46174539 GGGCCTCGTCGTCCCCGCGGTGG + Exonic
1175918218 20:62437459-62437481 GGTCCCTGTCTACCCTGCGGGGG - Intergenic
1184568861 22:45309846-45309868 GGTCCCCGGAGGCCCCGCCCCGG - Intronic
1185037908 22:48489390-48489412 CGCGCCCGCCGACCCCGCGCCGG - Intergenic
968616616 4:1580480-1580502 GGGCTCCGTGCACCCCGCGCCGG - Intergenic
983576965 4:169270823-169270845 GGTCCCCGTCGACCCCGCGCCGG + Intronic
986330402 5:6713238-6713260 GGGCCCCGTCGGCCGCGGGCGGG - Intergenic
998157603 5:139795587-139795609 TGTCCCCCTCTGCCCCGCGCGGG - Intergenic
1004694446 6:18020407-18020429 GCTGCCTGTCAACCCCGCGCCGG - Intergenic
1010703165 6:79077288-79077310 GGCCCCCGCAGACCCCGCGCCGG + Intronic
1034911879 7:155003616-155003638 GGCCCCGGTCTACACCGCGCTGG + Intergenic
1038182785 8:25244636-25244658 GGTCCGCGAGGACCCCGTGCAGG + Intronic
1042591650 8:70403240-70403262 GGTCTCCGCCGACCCCGCACCGG + Intronic
1054798516 9:69324983-69325005 GGTCCCCGCCGAACCTGCGCCGG - Intronic
1061231614 9:129319046-129319068 GCCCCCCGTCGCCCCCGCCCTGG + Intergenic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1062363706 9:136199133-136199155 AGGCCCCGACGTCCCCGCGCCGG - Intronic