ID: 983580043

View in Genome Browser
Species Human (GRCh38)
Location 4:169300395-169300417
Sequence GTGCCCTGATCAATGTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983580043_983580049 27 Left 983580043 4:169300395-169300417 CCCTGGGACATTGATCAGGGCAC No data
Right 983580049 4:169300445-169300467 ACAGGTAACCAAAGCAAACATGG No data
983580043_983580045 9 Left 983580043 4:169300395-169300417 CCCTGGGACATTGATCAGGGCAC No data
Right 983580045 4:169300427-169300449 CAGTAATACCCCACAAGCACAGG 0: 9
1: 184
2: 512
3: 743
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983580043 Original CRISPR GTGCCCTGATCAATGTCCCA GGG (reversed) Intergenic
No off target data available for this crispr