ID: 983580043 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:169300395-169300417 |
Sequence | GTGCCCTGATCAATGTCCCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
983580043_983580049 | 27 | Left | 983580043 | 4:169300395-169300417 | CCCTGGGACATTGATCAGGGCAC | No data | ||
Right | 983580049 | 4:169300445-169300467 | ACAGGTAACCAAAGCAAACATGG | No data | ||||
983580043_983580045 | 9 | Left | 983580043 | 4:169300395-169300417 | CCCTGGGACATTGATCAGGGCAC | No data | ||
Right | 983580045 | 4:169300427-169300449 | CAGTAATACCCCACAAGCACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
983580043 | Original CRISPR | GTGCCCTGATCAATGTCCCA GGG (reversed) | Intergenic | ||