ID: 983581572

View in Genome Browser
Species Human (GRCh38)
Location 4:169314663-169314685
Sequence TTGTTTTACCACATCATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983581572_983581574 -3 Left 983581572 4:169314663-169314685 CCCTTCATGATGTGGTAAAACAA No data
Right 983581574 4:169314683-169314705 CAAAGACATATCAAAACCAGAGG No data
983581572_983581576 25 Left 983581572 4:169314663-169314685 CCCTTCATGATGTGGTAAAACAA No data
Right 983581576 4:169314711-169314733 CTTGTCAAGTTTCTAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983581572 Original CRISPR TTGTTTTACCACATCATGAA GGG (reversed) Intergenic
No off target data available for this crispr