ID: 983582676

View in Genome Browser
Species Human (GRCh38)
Location 4:169324820-169324842
Sequence GACAGCTCTTGGCTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983582674_983582676 11 Left 983582674 4:169324786-169324808 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG No data
983582673_983582676 15 Left 983582673 4:169324782-169324804 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983582676 Original CRISPR GACAGCTCTTGGCTTGTTAC TGG Intergenic
No off target data available for this crispr