ID: 983584400

View in Genome Browser
Species Human (GRCh38)
Location 4:169340063-169340085
Sequence CCACTCAGATAGTACAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983584395_983584400 11 Left 983584395 4:169340029-169340051 CCAGACTTCTTAGGGTCCCATTT No data
Right 983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG No data
983584397_983584400 -5 Left 983584397 4:169340045-169340067 CCCATTTGAGACAGATGGCCACT No data
Right 983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG No data
983584398_983584400 -6 Left 983584398 4:169340046-169340068 CCATTTGAGACAGATGGCCACTC No data
Right 983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG No data
983584392_983584400 24 Left 983584392 4:169340016-169340038 CCAACAGGAGAATCCAGACTTCT No data
Right 983584400 4:169340063-169340085 CCACTCAGATAGTACAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983584400 Original CRISPR CCACTCAGATAGTACAAGCC TGG Intergenic
No off target data available for this crispr