ID: 983590603

View in Genome Browser
Species Human (GRCh38)
Location 4:169406677-169406699
Sequence CTTATGGATGTTCCCACCGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983590603_983590607 4 Left 983590603 4:169406677-169406699 CCTACGGTGGGAACATCCATAAG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 983590607 4:169406704-169406726 CTGAACAGCTTTGAGAGATCTGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983590603 Original CRISPR CTTATGGATGTTCCCACCGT AGG (reversed) Exonic
901989437 1:13100802-13100824 CTCAGGGATCTTCCCACAGTGGG + Intergenic
901992376 1:13125962-13125984 CTCAGGGATCTTCCCACAGTGGG - Intergenic
908945073 1:69485972-69485994 CATGTGGAGGTTCCTACCGTGGG - Intergenic
910177082 1:84442658-84442680 CTTATGGAAGTTCCTACAGAAGG - Intergenic
912320234 1:108706125-108706147 CATATGGATGCTCCCTCCTTTGG + Intergenic
1087152409 11:94870530-94870552 ATTCTGCATGTTCCCACTGTGGG + Intronic
1090503406 11:127283940-127283962 ATGATGGATATTCCCACCTTAGG + Intergenic
1096549134 12:52360732-52360754 CTTCTGGATGTTCCTACAGAGGG - Exonic
1106495010 13:30268155-30268177 CTTAGGGATGTTACCTGCGTAGG - Intronic
1109362216 13:61308791-61308813 CTCATGGATTTTTCTACCGTTGG + Intergenic
1126014332 15:44335612-44335634 CTCATGGATTTTCTCACCCTTGG + Intronic
1144105195 17:11978029-11978051 CTTATAAATGTTCGCACTGTGGG - Exonic
1154352276 18:13594241-13594263 CTTGTGGCTTTTCCCTCCGTTGG + Intronic
1165565202 19:36720151-36720173 CTTATGAATGTCCTCACTGTGGG + Exonic
940389750 2:153118464-153118486 CTTTTGGATCTTCCCACATTGGG + Intergenic
940466734 2:154039151-154039173 CTAATTGATGTTCCCACCAATGG - Intronic
1169157623 20:3346325-3346347 CTTATGTATGTTCCTATTGTTGG - Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
956780467 3:72599373-72599395 CATATAGATGTGCCCACCCTGGG + Intergenic
964242811 3:154616306-154616328 CTCAGGGATGTGCCCACTGTAGG - Intergenic
970816318 4:20160496-20160518 CTTCTGGATCTTCCCAGTGTGGG - Intergenic
974687080 4:65243939-65243961 CTCCTGGATGTTCACACCTTTGG + Intergenic
978925564 4:114238630-114238652 CCTATGGATATTTCCAACGTAGG + Intergenic
983590603 4:169406677-169406699 CTTATGGATGTTCCCACCGTAGG - Exonic
984405123 4:179319479-179319501 CATAAGGATGTCCCCACCTTTGG - Intergenic
985757908 5:1730197-1730219 TTTATGGATGTTCACAGAGTGGG + Intergenic
990968959 5:61482024-61482046 CTGTTAGATATTCCCACCGTTGG - Intronic
1016645883 6:146407626-146407648 GTTATGAATGTACCCACCTTGGG - Intronic
1021549775 7:21858497-21858519 ATTTTGCATGTTCCCACAGTGGG + Intronic
1021795230 7:24247907-24247929 ATTATTGATATTCCCACAGTGGG - Intergenic
1029289810 7:99493706-99493728 CCTATGGATGTTCCGTCTGTGGG - Exonic
1032836308 7:135678133-135678155 CTTGTGGAAGTTCCCAGGGTGGG + Intronic
1035879214 8:3226084-3226106 CATTTGAATGTTCACACCGTTGG + Intronic
1045036131 8:98177942-98177964 CTTCTGGGTGCTCCCACCGCAGG - Intergenic
1046482291 8:114837952-114837974 ATTCTGGATATTCCCACAGTTGG - Intergenic
1049516988 8:143065099-143065121 CTGATGGATGTTGTCATCGTGGG + Intergenic
1187901001 X:24026208-24026230 TTTATGAATTTTCCCACCCTTGG - Intronic
1193531540 X:82660408-82660430 CTTCTGGATGCTCCCATTGTGGG + Intergenic