ID: 983608071

View in Genome Browser
Species Human (GRCh38)
Location 4:169612651-169612673
Sequence CGCAGCGGAGGCGGCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983608061_983608071 27 Left 983608061 4:169612601-169612623 CCGGCGCGTCACCGGCGCTGGCG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 983608071 4:169612651-169612673 CGCAGCGGAGGCGGCTGGGAAGG 0: 1
1: 0
2: 3
3: 20
4: 377
983608062_983608071 16 Left 983608062 4:169612612-169612634 CCGGCGCTGGCGTGTGACGTCAG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 983608071 4:169612651-169612673 CGCAGCGGAGGCGGCTGGGAAGG 0: 1
1: 0
2: 3
3: 20
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983608071 Original CRISPR CGCAGCGGAGGCGGCTGGGA AGG Intronic