ID: 983613911

View in Genome Browser
Species Human (GRCh38)
Location 4:169679857-169679879
Sequence CAACAGAGGGAGACCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 87, 2: 23, 3: 37, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983613911 Original CRISPR CAACAGAGGGAGACCGTGGA AGG Intronic
900146319 1:1160401-1160423 CAAGGGAGGGAGACAGTAGAGGG + Intergenic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900714732 1:4137008-4137030 CAAGAGAGGGAGAGGATGGAAGG - Intergenic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901826577 1:11865812-11865834 GTACAGAGGGAGACCATGGGAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905376034 1:37520866-37520888 CAACAGAGAGAGATCCTGGGAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907560226 1:55381156-55381178 CAAGAGAGTGGGACAGTGGAGGG - Intergenic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912028374 1:105206761-105206783 CAAGAGAGAGAGACAGTGAATGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912987344 1:114447256-114447278 CAACAGAGGTAGTACGTGGTAGG + Intronic
913583559 1:120250766-120250788 CTACACAGTGAGACTGTGGAGGG - Intergenic
913624617 1:120647554-120647576 CTACACAGTGAGACTGTGGAGGG + Intergenic
914565547 1:148862602-148862624 CTACACAGTGAGACTGTGGAGGG - Intronic
914607278 1:149267650-149267672 CTACACAGTGAGACTGTGGAGGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915342368 1:155183719-155183741 TACCAGAGGGAGACGCTGGAAGG - Intronic
916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG + Intergenic
916723795 1:167505073-167505095 CACCAGAGGAAGCCCTTGGAAGG - Intronic
917219749 1:172716344-172716366 CATCAGAGTGAGCCCCTGGAGGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917596557 1:176535024-176535046 AACCAGAGGGAGACTGTAGAAGG + Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
919774184 1:201183535-201183557 CTACAGTGGGCGACCGTGCAAGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924836373 1:247651817-247651839 CAACAGAGAGAGAGCGGGGAGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1064822115 10:19348979-19349001 CGACAGAGTGAGACTGTTGAAGG - Intronic
1065164496 10:22960900-22960922 CAACAGAGGGAGAGCTTGCTGGG - Intronic
1065289336 10:24214458-24214480 AAAGAGAGAGAGAACGTGGAAGG + Intronic
1068396284 10:56466080-56466102 CAGCAGGTGGAGACTGTGGATGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1069667593 10:70173853-70173875 CAACACTGGGAGACCGAGGCAGG + Intergenic
1070916948 10:80161111-80161133 CAAAAGAGGAAGCCAGTGGAGGG - Intronic
1071270742 10:84004967-84004989 AAAAAGAGAGAGACAGTGGAAGG + Intergenic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1076239924 10:128897083-128897105 CAAGAGAGGGAAAGAGTGGAAGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1081746010 11:45473095-45473117 CCACAGAGGGAGACCGTTGGTGG - Intergenic
1082706037 11:56496522-56496544 AGGGAGAGGGAGACCGTGGAAGG - Intergenic
1082706044 11:56496547-56496569 AGGAAGAGGGAGACCGTGGAGGG - Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083187551 11:61026471-61026493 CAACAAAGGGAGACAAAGGAGGG + Intergenic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088184103 11:107144246-107144268 CAGCAGTGGGAGACTGTAGAGGG - Intergenic
1088796012 11:113267493-113267515 CAACAGAGAGCCACCCTGGAGGG + Intronic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1088883443 11:113989419-113989441 CAAGAGAGGGAGACCCCGGGTGG - Intronic
1089328713 11:117675315-117675337 CAACAGAGCGAGATCCTGGCTGG - Intronic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091128511 11:133123728-133123750 CCACAGAGAGAGACCCAGGAAGG - Intronic
1091776720 12:3189469-3189491 CTACAGAGGGAGAGGGTGCAGGG + Intronic
1092053911 12:5493256-5493278 CAACAGAATGAGAGCGTGGATGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095701982 12:45200136-45200158 CAACAGAGGGAAAGAGTGGGAGG - Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1097018215 12:56002166-56002188 CAAGATAGGGAGACCCTGGGAGG - Exonic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102515134 12:113441293-113441315 CAACAGCACGAGACCGTGGGTGG - Intergenic
1103045225 12:117730501-117730523 AGGGAGAGGGAGACCGTGGAAGG - Intronic
1103497135 12:121371526-121371548 CAACAGAGAGAGAGAGAGGAAGG - Intronic
1104941777 12:132398586-132398608 CAACACCGGGAGGCCCTGGAGGG - Intergenic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106549318 13:30757915-30757937 CTAAAGAGGGAGACCAGGGAGGG - Intronic
1107424198 13:40276405-40276427 CAACAGAAGGAGCCCGGTGAAGG + Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1119054716 14:71407524-71407546 CAACAAAGTGAGACCCTGGGAGG - Intronic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119706585 14:76786695-76786717 CAACAGAGGTAGGCCTAGGAAGG + Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1120432095 14:84432187-84432209 CAAGAGAATGAGACCGTAGATGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122608698 14:102965935-102965957 CAACAGAGTGAGACTGTCGCGGG + Intronic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127946947 15:63764925-63764947 CAACAGAGCAAGACCCTAGAAGG - Intronic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128391476 15:67185554-67185576 CAACAGCATGAGGCCGTGGAAGG + Intronic
1128704187 15:69826740-69826762 CAAGAGAGAGATACCATGGACGG + Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1131089317 15:89609357-89609379 CAACTGTGGGAGGCCGAGGAGGG - Intronic
1131153282 15:90060028-90060050 CAACAGAGCAAGAGCGGGGAGGG - Intronic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1134124045 16:11604142-11604164 CAACATAGTGAGACACTGGAGGG + Intronic
1135325922 16:21525844-21525866 GGACACAGGGAGACCGTGGTTGG + Intergenic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135866810 16:26110810-26110832 TGAGAGAGGGAGACAGTGGAAGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136682838 16:31977984-31978006 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136783476 16:32921550-32921572 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1136886312 16:33932299-33932321 CAAAACTGGGAGACAGTGGAGGG - Intergenic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1138623362 16:58230033-58230055 AAACAGAGGGATGCCTTGGAGGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139342245 16:66275210-66275232 CAAGAGAGAGAGACAGTGAAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140045304 16:71436699-71436721 CAACAGTGGGTGACTGTGGGAGG + Intergenic
1140051377 16:71484420-71484442 CACCAGAGGGAGACCGGGACCGG + Intronic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1142038955 16:87880535-87880557 GGACACAGGGAGACCGTGGTTGG + Intergenic
1203086126 16_KI270728v1_random:1185534-1185556 CAAAACTGGGAGACAGTGGAGGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143900885 17:10173911-10173933 GAGCACAGGGAGACGGTGGAGGG + Intronic
1144171234 17:12661844-12661866 CAACACTGGGAGGCCGAGGAGGG + Intergenic
1145930596 17:28682599-28682621 CAACAGAGCGAGACCGTCTCAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147143748 17:38473743-38473765 CAAAACTGGGAGACAGTGGAGGG + Intronic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1147311919 17:39600538-39600560 CAACAGAGGGGCAGCGCGGAGGG - Intergenic
1148780747 17:50120085-50120107 CAATAGGGGGAGGGCGTGGATGG + Intronic
1150245661 17:63672998-63673020 CAACAGAGGAACCCAGTGGAAGG - Intronic
1150369534 17:64624804-64624826 CAACAGAGCAAGACAGGGGAGGG + Intronic
1150767286 17:68012218-68012240 CAACAGAGCAAGACCGTGTCTGG + Intergenic
1151044946 17:70908919-70908941 CAATAGAGTGAGACCCTGGGAGG - Intergenic
1151432126 17:74070823-74070845 CAAGCTAGGGAGGCCGTGGAAGG - Intergenic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152104020 17:78318534-78318556 CATCAGAGGGTGACCCTGGGAGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1154091666 18:11369705-11369727 CAAAAGAGAGAGAGCGTGAAGGG + Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155544503 18:26901603-26901625 TAACAGAGGCAGAGCTTGGAGGG + Intergenic
1157110839 18:44818825-44818847 TCACAGAGGGAGATGGTGGAAGG - Intronic
1157849863 18:51038235-51038257 CTACAGAGCGAGACTGTGGGGGG + Intronic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1161154737 19:2726776-2726798 CCACAGGGAGAGACCCTGGAGGG + Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1161789857 19:6353355-6353377 CAACAGAGGGAAAGAGTTGAAGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG + Intergenic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167357061 19:49010662-49010684 GAACAGAGGGAGCCCGAGGGAGG - Intronic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167554043 19:50181819-50181841 CAACAGAGAAAGACCCTGGAGGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1168275350 19:55274845-55274867 CCACAGAGGGACAACATGGAGGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926412730 2:12621220-12621242 CAACACTGGGAGGCCGAGGAGGG + Intergenic
927810985 2:26180039-26180061 CAACAGAGGAAAAATGTGGAGGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928009654 2:27595107-27595129 CAACAGAGGGAGACCGAAGAAGG + Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
934987066 2:98895245-98895267 CAACAGAGGGAGGGCCTTGATGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938181520 2:129189105-129189127 GAACAGAGGGAGACAGAGCAGGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940012743 2:149072176-149072198 AAACATAGGGAGACTGAGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942179318 2:173364957-173364979 AGAAAGAGGAAGACCGTGGATGG + Exonic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944316531 2:198291099-198291121 CTACAGGGAGAGACCGAGGAGGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
947467139 2:230361296-230361318 AAACAGAGGGATTCCCTGGAAGG - Intronic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169454682 20:5741838-5741860 CAACAGAGTGAGACCGTATCCGG + Intergenic
1169548532 20:6676518-6676540 AAACAGAGGGAGGCCGAGGCAGG - Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1172916669 20:38448483-38448505 CTACAGAGGAAGACAGCGGATGG - Intergenic
1172937019 20:38627745-38627767 CAACATAGGGACATAGTGGAAGG - Intronic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1174306031 20:49614937-49614959 AAACAAAGGGAGAACGGGGAGGG + Intergenic
1174585767 20:51606876-51606898 AAACAGAGTGAGACCCTGGGTGG - Intronic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177255237 21:18652888-18652910 CAACAGAGAGAGTCCATGAAGGG - Intergenic
1181147700 22:20860335-20860357 CAACAGACCGAGATCCTGGAGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181957921 22:26601747-26601769 CAGCACTGGGAGACTGTGGAAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1185283869 22:49990568-49990590 CAACAGAGGGAGACCAGAGAGGG + Intergenic
949836851 3:8279263-8279285 GAAAAGAGGGAGACCGTGTAAGG + Intergenic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
950892319 3:16414969-16414991 TGACAGAGGAAGTCCGTGGAGGG + Intronic
951580799 3:24160410-24160432 CAAGAGAGGGTGAACCTGGAGGG + Intronic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952129331 3:30342006-30342028 ACACAGATGGAGACAGTGGAAGG - Intergenic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
954166627 3:48764604-48764626 CAACAGTGGGAGAACATAGAAGG + Intronic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
958487310 3:94729239-94729261 CAACATAGGGAGACCCAGGCTGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
965302009 3:167017489-167017511 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302033 3:167017576-167017598 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302043 3:167017607-167017629 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302051 3:167017632-167017654 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302109 3:167017849-167017871 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302119 3:167017880-167017902 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
965302127 3:167017905-167017927 AGGGAGAGGGAGACCGTGGAGGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969806198 4:9610936-9610958 CAACACTGGGAGACCGAGGCAGG + Intergenic
970192997 4:13532921-13532943 CAACAGAGCAAGACTCTGGACGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972702746 4:41509717-41509739 AAACAGATGGAGAACATGGAAGG + Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
978398203 4:108305063-108305085 GAACAGATCGAGACCGTGGATGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982110796 4:152051673-152051695 CAACACAGGGAGGCCGAGGCAGG - Intergenic
982723262 4:158881188-158881210 AGGGAGAGGGAGACCGTGGAGGG - Intronic
983079351 4:163366078-163366100 CAAGGGAGGGACACAGTGGAAGG + Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
984718912 4:182952281-182952303 CAATAGAGGGAGAGCGTGGCAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984804410 4:183737780-183737802 AGGGAGAGGGAGACCGTGGAGGG + Intergenic
985679129 5:1246818-1246840 GAACAGAGGGAGAGGGAGGAGGG - Intergenic
986784793 5:11104457-11104479 CAAGAGTGGCAGACGGTGGATGG - Intronic
988112675 5:26843279-26843301 CAACACTGGGAGACCAAGGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
997471554 5:134120135-134120157 CAACAGATGAAGACAGAGGAGGG + Intronic
998076792 5:139243149-139243171 CAAAAGAGTGAGACCTTGGCTGG + Intronic
1000024422 5:157346491-157346513 AAACAGAGGCAGAGAGTGGAAGG + Intronic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003319633 6:5038862-5038884 CCGCGGAAGGAGACCGTGGAGGG + Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1006647327 6:35523605-35523627 CAACAGTGGGAGGCCGAGGCAGG + Intergenic
1006788827 6:36685669-36685691 CAACTGAGGAAGACAGTGGGGGG - Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1006897856 6:37482242-37482264 GAACAGAGGAAGGGCGTGGATGG - Intronic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009392613 6:63163369-63163391 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013533782 6:111044522-111044544 GAACTGAGGGAGATCATGGAAGG - Intergenic
1013715947 6:112961754-112961776 CAAGAGAGGGAGATAGTGAAGGG - Intergenic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1014188653 6:118466023-118466045 ACACAGAGGGAGAGCGGGGAGGG + Intronic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1019057833 6:169235898-169235920 GGACAGAGGGAGAGTGTGGATGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023388582 7:39685307-39685329 AAACAGAAGGAGACCGTTGTGGG + Intronic
1024274232 7:47664931-47664953 CAACAGAGGGAGCTCGTGGTGGG + Intergenic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026535214 7:71233443-71233465 CAACAGAAGTAGACCTTAGAAGG + Intronic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1029296788 7:99546605-99546627 CAGCAGTGGGAGACCGAGGTGGG - Exonic
1032214991 7:129951324-129951346 CAACAGGGGGAAACGGTGGGGGG + Intronic
1032332175 7:130990779-130990801 CAGCAGAGGGAGATGGTGCAGGG - Intergenic
1033185542 7:139224890-139224912 CAACAGAGGGAGACCGAAGAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033825765 7:145187131-145187153 TGACAGAGGGAGACCCTGGAAGG - Intergenic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034550034 7:151814647-151814669 CAACAGATGGGGACCGGGGCTGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1037506786 8:19538637-19538659 GAACTGAGGGAGACCGGGGGAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038624279 8:29175687-29175709 CAACAAAAGGAGTCTGTGGAAGG + Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039426618 8:37491845-37491867 TGACAGAGTGAGACCTTGGAGGG - Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1045085003 8:98672360-98672382 CAACAGAGAGAAACCTTGTATGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046524051 8:115361342-115361364 CAGCAAGGGGAGACCGTGGCGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1047167217 8:122452495-122452517 GAACAGAGCGAGAGAGTGGAAGG + Intergenic
1047757806 8:127932018-127932040 CAACAGAGGAAGCCTGAGGATGG - Intergenic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1059716939 9:116921855-116921877 CAAGAGAGGGACCCAGTGGAAGG - Intronic
1059721513 9:116964481-116964503 CAACACTGTGAGACCGTGGCAGG + Intronic
1060079250 9:120625936-120625958 TAACAGAGAGAGACCATGAAAGG - Intronic
1062407898 9:136406110-136406132 CTACAGAGGGAGACCACAGACGG + Intronic
1062437221 9:136551597-136551619 AAAAAGAGGGAGACCGAGAAAGG - Intergenic
1185602363 X:1349025-1349047 CAACAGAGCAAGACCGTGTCAGG - Intronic
1186195715 X:7108799-7108821 CAACACTGGGAGACCGAGGCTGG - Intronic
1187204564 X:17169907-17169929 GGACAGAGGGAGAGCTTGGAGGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188995366 X:36878548-36878570 CAACAGAAGGAGAGCGTCTATGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190489718 X:50969541-50969563 CAACATAGCGAGACTGTGGCAGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192790105 X:74373194-74373216 CCACAGAGCGAGACCCTGGCTGG + Intergenic
1194713379 X:97262467-97262489 CAAGTGAGGGAGAACGTAGAAGG + Intronic
1197756983 X:130002479-130002501 AGACAGAGGGAGACCGGGGAGGG + Intronic
1201146255 Y:11066994-11067016 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201146552 Y:11067931-11067953 GAACAGAGGGAGAGGGAGGAAGG + Intergenic
1201553703 Y:15246250-15246272 GAACAAAGGGAGACCATGTATGG - Intergenic
1202028601 Y:20551023-20551045 CAACAGAGGGAGACCGAAGAAGG - Intergenic