ID: 983617878

View in Genome Browser
Species Human (GRCh38)
Location 4:169727920-169727942
Sequence CCAAAGGCAACATGAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983617873_983617878 3 Left 983617873 4:169727894-169727916 CCTTGAAGAAAGCATCTTACCTG No data
Right 983617878 4:169727920-169727942 CCAAAGGCAACATGAGCCATTGG 0: 1
1: 1
2: 0
3: 13
4: 155
983617872_983617878 7 Left 983617872 4:169727890-169727912 CCTACCTTGAAGAAAGCATCTTA No data
Right 983617878 4:169727920-169727942 CCAAAGGCAACATGAGCCATTGG 0: 1
1: 1
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983617878 Original CRISPR CCAAAGGCAACATGAGCCAT TGG Intergenic
900582545 1:3416202-3416224 CCAGAGACCACATGAGCCAGTGG - Intronic
902159608 1:14519530-14519552 CCAAAGGCAATCTGTGCCACTGG - Intergenic
904495335 1:30883404-30883426 CCAGAGGCGACATGAGCAAGGGG + Intronic
905217297 1:36417848-36417870 CCAAAAGCCTCCTGAGCCATAGG - Intronic
906949422 1:50322445-50322467 CCCAAGACCACATTAGCCATGGG + Intergenic
907362274 1:53927676-53927698 TCAAAGGCAACAGGTGCCATGGG - Intronic
908805035 1:67921570-67921592 CCAGAGGCATCTTGAACCATTGG + Intergenic
909100419 1:71341989-71342011 ACAAATGCAACAAGAGCCACAGG + Intergenic
912161827 1:106994889-106994911 CCAAAGGGCACATGAACCAACGG + Intergenic
912365314 1:109128647-109128669 CTAAAGGAAACCTGTGCCATTGG + Intronic
912719509 1:112007717-112007739 CCAAAAGCAGCATGAGGCTTGGG - Intergenic
915550881 1:156633369-156633391 CCTAAGGCTACAGCAGCCATTGG - Intergenic
916405014 1:164489514-164489536 CCAAAGGTAAAATAAGTCATTGG + Intergenic
916806988 1:168269059-168269081 CCAAAGGCCACATGTGAAATAGG - Intergenic
917185642 1:172351992-172352014 CAAAAGGCATCATGATCCACTGG + Intronic
919798299 1:201334915-201334937 CCAAAGGCAACAGGAGGAAATGG - Intergenic
920349511 1:205328609-205328631 CCAATGGCAACCTGAGCCCTTGG + Intergenic
923812865 1:237339792-237339814 CCAAAGGCAACATCATCTATAGG + Intronic
1068950213 10:62769354-62769376 GCCAAGGCAAGATGAGCAATGGG + Intergenic
1073189717 10:101642760-101642782 CCAAACACATCATGAGCCACAGG + Intronic
1074157786 10:110813266-110813288 GTAAAGGCAACAGGTGCCATGGG - Intronic
1076274664 10:129186955-129186977 GCAAAGGCCTCATAAGCCATAGG + Intergenic
1079134907 11:17770853-17770875 CCAAAGGCACCATAATCCATAGG - Intronic
1080274047 11:30483780-30483802 CACAAGGCTTCATGAGCCATGGG - Intronic
1082016751 11:47494685-47494707 CCAATGGCAAGCTGATCCATTGG + Intronic
1082902958 11:58276068-58276090 CCAAAGGGAACTTGAGCAAAAGG + Intergenic
1082942951 11:58727284-58727306 ACAAATGCAATAAGAGCCATGGG + Intronic
1083225735 11:61283317-61283339 TCAAAGGCATCGTGAGCTATGGG - Intronic
1084274052 11:68042915-68042937 CCAGAAGCACCATGAGCCCTAGG - Intronic
1091871307 12:3893468-3893490 CCAAAAGCTCCATGAGCCTTTGG + Intergenic
1094680831 12:32665661-32665683 CCAAAGGCAAAAAGAGTCAGGGG - Intergenic
1097709962 12:62907456-62907478 CCAAAGGCAGCATGGGACAGTGG - Intronic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1104576605 12:129972277-129972299 CCAAAGGCCATAGGAGCCCTTGG - Intergenic
1106330589 13:28735718-28735740 CCCAGGGGAACGTGAGCCATGGG + Intergenic
1107939736 13:45372969-45372991 CCAAAGGAAACACGAGCCCAAGG - Intergenic
1108825035 13:54403126-54403148 CAAATGGTAACATGAGCCTTGGG - Intergenic
1112174965 13:97013069-97013091 CCAATGGCAGCAGAAGCCATTGG - Intergenic
1112437125 13:99398573-99398595 CCAAAGGGAACAGGAGGCAGAGG - Intergenic
1117232870 14:53739719-53739741 GCAAAGGGACCATGAGCCATAGG + Intergenic
1117919430 14:60713696-60713718 CCAAGGGCAGCCTGAGTCATAGG + Exonic
1118685442 14:68286169-68286191 CCTAAGGCAACATGGGACACAGG - Intronic
1118900019 14:69978847-69978869 GACAAGCCAACATGAGCCATAGG + Intronic
1122065431 14:99170174-99170196 CCAAAGGCAACAGCAGCCCCTGG + Exonic
1122324701 14:100875245-100875267 CCAATGGCAACATGAGCAGGGGG + Intergenic
1124938680 15:34197479-34197501 CCAAAGGCAACTTGCCTCATAGG - Intronic
1128329497 15:66746295-66746317 CAAAAGGCTGCATGACCCATAGG + Intronic
1128439353 15:67689928-67689950 CCACGGGCCACATGAGCCACAGG + Intronic
1129436218 15:75542761-75542783 ACAAAGGAACCATGAGCCAAAGG - Intronic
1130287654 15:82569308-82569330 CCAAAGGCAACATGACGATTAGG + Intronic
1130295658 15:82646167-82646189 TCAAAGGGAACATGAGCCTCAGG + Intronic
1131576684 15:93599221-93599243 TCAAAGGCCACAGTAGCCATGGG - Intergenic
1133148106 16:3805770-3805792 CCACTGACACCATGAGCCATTGG - Intronic
1133517990 16:6528481-6528503 CCAAAGGCAACAGGAGCAAATGG + Intronic
1137795790 16:51217816-51217838 CCAAATACAGCATGAGCCACTGG - Intergenic
1138187669 16:54988757-54988779 CCAAAGGAAACTTGGGCCAGGGG - Intergenic
1140345273 16:74207245-74207267 CCTAAGGTAACATGAGACAGTGG - Intergenic
1141581234 16:85000789-85000811 CCAAAGACAGCCTGAGCCACAGG + Intronic
1142555158 17:770168-770190 ACAGAGGCAACGTGAGCCAGGGG + Intronic
1146250501 17:31338056-31338078 CCAAAGACAACAAGAGCTCTTGG - Exonic
1146798919 17:35803362-35803384 TCAAAGTCAAAATGAGTCATTGG + Intronic
1146828147 17:36041832-36041854 TCAAAGTCAAAATGAGTCATTGG - Intergenic
1148905459 17:50909221-50909243 CCCAAGGCTACAAGGGCCATTGG - Intergenic
1150007758 17:61480110-61480132 CCAAAAGCATCATGAGGCAGAGG + Exonic
1153620423 18:6972519-6972541 CAAACAGCAAGATGAGCCATTGG + Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167434734 19:49472912-49472934 CCATGGGCCACATGAGCTATTGG + Intronic
925298981 2:2796461-2796483 CCACAGGCAGCAGGTGCCATGGG - Intergenic
927572289 2:24170185-24170207 TCAAACTCAACATGAGCCAGAGG - Intronic
927719993 2:25376474-25376496 CCAATGGGAAGATGAGCTATGGG + Intergenic
928430472 2:31214515-31214537 CCAAAGGGAACATGCACCTTGGG + Intronic
928592257 2:32829362-32829384 CCAAAGATAACATGAGCAAATGG + Intergenic
928845019 2:35661214-35661236 CCTAAGCCAACATTAGCCAATGG + Intergenic
929127283 2:38533370-38533392 CCAAAGGCAACGTGAAACACTGG - Intergenic
932401904 2:71486489-71486511 CCAAATGCCCCAGGAGCCATAGG - Intronic
932990900 2:76785906-76785928 CCACAAACAAAATGAGCCATGGG + Intronic
933244555 2:79961281-79961303 ACAAAGGTAACATGAGCTAATGG - Intronic
934142187 2:89057327-89057349 ACATAGGCAAAATGAGCCCTAGG + Intergenic
934227052 2:90143219-90143241 ACATAGGCAAAATGAGCCCTAGG - Intergenic
935060250 2:99601115-99601137 CCAAGGGAGACCTGAGCCATAGG + Intronic
935486758 2:103665670-103665692 CTTAAGGCAACATGACCCCTTGG - Intergenic
937906152 2:127053831-127053853 CAATAGGCAACATGAGCCCAGGG + Intronic
940025198 2:149199400-149199422 CAAAAGTCAATATGAGCCACTGG - Intronic
941202940 2:162536770-162536792 CAAAAGGTAACATGAGCTAATGG + Intronic
947552854 2:231059301-231059323 TCTAAGCCAACATGAGCCATAGG - Intronic
947795702 2:232892760-232892782 CCAAGGTCCACATGAGCCACCGG - Intronic
948123606 2:235548907-235548929 CCAAAGGCAATATAAGCGAAAGG - Intronic
948486571 2:238285102-238285124 CAAAAGCCAACATGAGCCTCTGG + Intronic
1169329263 20:4703934-4703956 ACAAAGGAAACATGAGGCCTGGG - Intergenic
1169334457 20:4744184-4744206 ACAAAGGGAACATTGGCCATGGG + Intergenic
1170464746 20:16612305-16612327 CCACAGGCAATATGTGACATTGG - Intergenic
1174193132 20:48754474-48754496 CCCCAGGCAACAGCAGCCATGGG - Intronic
1175287438 20:57846348-57846370 CCTAATGCAACAGTAGCCATTGG - Intergenic
1177965935 21:27726182-27726204 ACAAATGCAGCAAGAGCCATGGG + Intergenic
1181161369 22:20961880-20961902 GCACAGCCAACATGAGCCAAGGG - Intergenic
1182979130 22:34651675-34651697 CCCAAGACAAAATGAGCCACAGG + Intergenic
1183207736 22:36431273-36431295 CCAAAGGTAAACTGAGCCAGTGG + Intergenic
1184741113 22:46429656-46429678 CCAAAGCCACCAGAAGCCATGGG - Intronic
1184954534 22:47876908-47876930 TCAAAGGAAACCTGACCCATGGG - Intergenic
949421523 3:3871508-3871530 CCAGAGGGAACATGGCCCATTGG - Intronic
950077020 3:10194534-10194556 CCAAAGGCAGGATGAGGCAAAGG - Intronic
950836837 3:15928264-15928286 CCATGTGTAACATGAGCCATGGG + Intergenic
951428812 3:22582467-22582489 CCAGAGGCAACATGATTTATGGG - Intergenic
952531050 3:34262408-34262430 CCCTAGGCATCATTAGCCATAGG - Intergenic
953772845 3:45792144-45792166 CCAATGTCAAGGTGAGCCATGGG + Intronic
953875208 3:46662686-46662708 CCGAAGGCAACATGGGTCTTGGG - Intergenic
955849789 3:63207439-63207461 CCAAAGGGAAAATGACTCATAGG + Intergenic
958181536 3:90066634-90066656 CCAAAGGGGACATGGGCCTTGGG + Intergenic
959505860 3:107155935-107155957 CCCAAGCCAACAGAAGCCATGGG + Intergenic
959842082 3:110988979-110989001 CCAAAGGCATCCTGAGCAAAAGG + Intergenic
960403534 3:117232258-117232280 CCAAAAGGAAAATGAGGCATCGG + Intergenic
961003022 3:123386626-123386648 CTCAAGGCTACCTGAGCCATGGG + Intronic
963454113 3:145522204-145522226 GCAAAGGCAACACCAGCCACAGG - Intergenic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
965038548 3:163473946-163473968 TCAAAGGCAACAACAGACATTGG - Intergenic
965268148 3:166575186-166575208 CCTATGGCAAAATGAGCCATTGG - Intergenic
969119900 4:4900447-4900469 CCAATAACAACATCAGCCATTGG + Intergenic
969864995 4:10069487-10069509 CCAAACCCAACAGGAGCCATAGG - Intergenic
971048246 4:22830362-22830384 AAAAAGGCAACATGAGCAATGGG + Intergenic
971203383 4:24535092-24535114 CCAAAGGGATGATTAGCCATTGG - Intronic
972874567 4:43342851-43342873 CCAAAAGCAAAATGGGCCTTTGG - Intergenic
979623527 4:122821927-122821949 CCAAATGCAACAAAAGCCATTGG + Intergenic
980420412 4:132552194-132552216 CCAAAGGAAACATGGGAAATAGG + Intergenic
980849652 4:138365619-138365641 GCTAAGGCAACATTAGCCAGAGG + Intergenic
983262840 4:165475463-165475485 ACAAATGCAGCAAGAGCCATGGG + Intronic
983617878 4:169727920-169727942 CCAAAGGCAACATGAGCCATTGG + Intergenic
986066765 5:4241555-4241577 CCAAAAGAACCAAGAGCCATAGG - Intergenic
987547998 5:19338849-19338871 CAGAAGGCAAAATGAACCATGGG - Intergenic
988287138 5:29234805-29234827 CCTAACCCAACATGATCCATGGG + Intergenic
989377732 5:40782412-40782434 CCAAAAGCAACCTGGGCTATGGG + Intronic
989626906 5:43438393-43438415 CCAAAAGAAACAGGAGCCAAGGG + Intergenic
989792467 5:45422182-45422204 CAAAAGGCAACATGATCTAATGG - Intronic
998111021 5:139502782-139502804 CCCAAGGAAACATCAGCCTTTGG - Intergenic
1001158956 5:169297653-169297675 CCCATGGCAACATGAACCCTGGG + Intronic
1008721900 6:54364169-54364191 CCAAAGGGATCATTAGGCATTGG + Intronic
1012231023 6:96761784-96761806 GCAAAGGCACCACGAGCCACAGG - Intergenic
1013194963 6:107837002-107837024 ACAAAGGCCACATGAGAGATTGG - Intergenic
1018629082 6:165806516-165806538 CCAAAGGGAAAAGGAGCCAGAGG - Intronic
1019128028 6:169854223-169854245 CCAAAGCCAACATGGGCCCAGGG - Intergenic
1019870809 7:3759136-3759158 ATAAAGGAAAAATGAGCCATAGG - Intronic
1022063941 7:26831190-26831212 ACATAGGCATCATGAGCCTTGGG - Intronic
1023395453 7:39747638-39747660 CCTAAGGCCACATTAGCCTTAGG + Intergenic
1024061624 7:45702931-45702953 CCAGAGGAAACAGGAGCCTTAGG + Intronic
1025024371 7:55504425-55504447 CCAAAGGATACATGAGCCTCTGG + Intronic
1030722089 7:112882327-112882349 ACAAAGGCACCACCAGCCATAGG + Intronic
1030750122 7:113222234-113222256 CCAAAAGAAACATGGGCCAAAGG - Intergenic
1031476890 7:122234139-122234161 CCAAAAGCAAAATAAGCCAAAGG + Intergenic
1034481408 7:151322538-151322560 CCAAAGGTGCCATGAGCCACAGG + Intergenic
1035059136 7:156056271-156056293 CCAAAATCAAGGTGAGCCATAGG - Intergenic
1035797707 8:2374578-2374600 AAAAAGGTAACATGAGCCAGAGG - Intergenic
1040017105 8:42708633-42708655 GCCAAGGCCACAGGAGCCATGGG + Intronic
1040535701 8:48307719-48307741 CCAAAGGCAAAATGAGCAAGAGG - Intergenic
1041393343 8:57367408-57367430 GCAAATGCAACAAGAGCCACAGG - Intergenic
1042343382 8:67703620-67703642 ACAAATGCAGCAAGAGCCATGGG - Intronic
1042593997 8:70425813-70425835 CCAAAGGCATCACCAGGCATGGG - Intergenic
1046535892 8:115509769-115509791 CCTAAGGCACCATGAGACACTGG - Intronic
1050071432 9:1818681-1818703 CCCCAGGCTACATGAGCCAGAGG - Intergenic
1051237904 9:15021227-15021249 CCAAAGGCAGCATGAGCCATTGG - Intergenic
1051888828 9:21923129-21923151 ACAAATGCAACAAGAGCCATGGG - Intronic
1055093053 9:72382258-72382280 CAAAAGGAAACACGAGACATAGG + Intergenic
1059614409 9:115932996-115933018 CCAAAACCAACATCGGCCATAGG + Intergenic
1186786544 X:12961550-12961572 CCAATGAGAACAAGAGCCATTGG - Intergenic
1187241388 X:17517069-17517091 CCAACAGGAACATTAGCCATTGG + Intronic
1193310199 X:79998842-79998864 CCAAAGAGAAGATGAGACATGGG + Intergenic
1194697376 X:97070579-97070601 CCAAAGGCAATAATAGCCACTGG + Intronic
1194914389 X:99686958-99686980 CCAAAGTAAACATGTGTCATAGG - Intergenic
1195943314 X:110182762-110182784 CCTAGGGCACCCTGAGCCATGGG + Intergenic
1196862851 X:120043865-120043887 CCAAAGGCAAGATGGGACTTTGG - Intergenic
1196880251 X:120192479-120192501 CCAAAGGCAAGATGGGACTTTGG + Intergenic
1200845384 Y:7827272-7827294 CTAAAGGAACCCTGAGCCATGGG - Intergenic