ID: 983622392

View in Genome Browser
Species Human (GRCh38)
Location 4:169774780-169774802
Sequence GGAACTACAGGAAGATGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622392_983622401 11 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622392_983622406 16 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG No data
983622392_983622407 17 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622392_983622408 18 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622408 4:169774821-169774843 TCCTATCCTGCTGTGGACCGGGG No data
983622392_983622411 28 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622392 Original CRISPR GGAACTACAGGAAGATGGAA CGG (reversed) Intergenic
No off target data available for this crispr