ID: 983622393

View in Genome Browser
Species Human (GRCh38)
Location 4:169774785-169774807
Sequence AGGGAGGAACTACAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622393_983622408 13 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622408 4:169774821-169774843 TCCTATCCTGCTGTGGACCGGGG No data
983622393_983622411 23 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622393_983622407 12 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622393_983622412 27 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622412 4:169774835-169774857 GGACCGGGGCGTCTCCTGGAAGG No data
983622393_983622401 6 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622393_983622406 11 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622393 Original CRISPR AGGGAGGAACTACAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr