ID: 983622397

View in Genome Browser
Species Human (GRCh38)
Location 4:169774792-169774814
Sequence CTCCCCAAGGGAGGAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622397_983622406 4 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG No data
983622397_983622407 5 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622397_983622408 6 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622408 4:169774821-169774843 TCCTATCCTGCTGTGGACCGGGG No data
983622397_983622401 -1 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622397_983622412 20 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622412 4:169774835-169774857 GGACCGGGGCGTCTCCTGGAAGG No data
983622397_983622411 16 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622397 Original CRISPR CTCCCCAAGGGAGGAACTAC AGG (reversed) Intergenic
No off target data available for this crispr