ID: 983622400

View in Genome Browser
Species Human (GRCh38)
Location 4:169774805-169774827
Sequence GATAGGATGGGGGCTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622400_983622415 25 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622415 4:169774853-169774875 GAAGGCCCGCGATCGAGATGAGG No data
983622400_983622406 -9 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622406 4:169774819-169774841 CATCCTATCCTGCTGTGGACCGG No data
983622400_983622407 -8 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622400_983622412 7 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622412 4:169774835-169774857 GGACCGGGGCGTCTCCTGGAAGG No data
983622400_983622411 3 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622400_983622408 -7 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622408 4:169774821-169774843 TCCTATCCTGCTGTGGACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622400 Original CRISPR GATAGGATGGGGGCTCCCCA AGG (reversed) Intergenic
No off target data available for this crispr