ID: 983622401

View in Genome Browser
Species Human (GRCh38)
Location 4:169774814-169774836
Sequence GCCCCCATCCTATCCTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622398_983622401 -10 Left 983622398 4:169774801-169774823 CCTCCCTTGGGGAGCCCCCATCC No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622397_983622401 -1 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622391_983622401 12 Left 983622391 4:169774779-169774801 CCCGTTCCATCTTCCTGTAGTTC No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622393_983622401 6 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data
983622392_983622401 11 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622401 4:169774814-169774836 GCCCCCATCCTATCCTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622401 Original CRISPR GCCCCCATCCTATCCTGCTG TGG Intergenic
No off target data available for this crispr