ID: 983622407

View in Genome Browser
Species Human (GRCh38)
Location 4:169774820-169774842
Sequence ATCCTATCCTGCTGTGGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622398_983622407 -4 Left 983622398 4:169774801-169774823 CCTCCCTTGGGGAGCCCCCATCC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622399_983622407 -7 Left 983622399 4:169774804-169774826 CCCTTGGGGAGCCCCCATCCTAT No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622392_983622407 17 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622400_983622407 -8 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622397_983622407 5 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622393_983622407 12 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data
983622391_983622407 18 Left 983622391 4:169774779-169774801 CCCGTTCCATCTTCCTGTAGTTC No data
Right 983622407 4:169774820-169774842 ATCCTATCCTGCTGTGGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622407 Original CRISPR ATCCTATCCTGCTGTGGACC GGG Intergenic
No off target data available for this crispr