ID: 983622411

View in Genome Browser
Species Human (GRCh38)
Location 4:169774831-169774853
Sequence CTGTGGACCGGGGCGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622402_983622411 -7 Left 983622402 4:169774815-169774837 CCCCCATCCTATCCTGCTGTGGA No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622398_983622411 7 Left 983622398 4:169774801-169774823 CCTCCCTTGGGGAGCCCCCATCC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622391_983622411 29 Left 983622391 4:169774779-169774801 CCCGTTCCATCTTCCTGTAGTTC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622397_983622411 16 Left 983622397 4:169774792-169774814 CCTGTAGTTCCTCCCTTGGGGAG No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622405_983622411 -10 Left 983622405 4:169774818-169774840 CCATCCTATCCTGCTGTGGACCG No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622392_983622411 28 Left 983622392 4:169774780-169774802 CCGTTCCATCTTCCTGTAGTTCC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622400_983622411 3 Left 983622400 4:169774805-169774827 CCTTGGGGAGCCCCCATCCTATC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622393_983622411 23 Left 983622393 4:169774785-169774807 CCATCTTCCTGTAGTTCCTCCCT No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622399_983622411 4 Left 983622399 4:169774804-169774826 CCCTTGGGGAGCCCCCATCCTAT No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622404_983622411 -9 Left 983622404 4:169774817-169774839 CCCATCCTATCCTGCTGTGGACC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data
983622403_983622411 -8 Left 983622403 4:169774816-169774838 CCCCATCCTATCCTGCTGTGGAC No data
Right 983622411 4:169774831-169774853 CTGTGGACCGGGGCGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622411 Original CRISPR CTGTGGACCGGGGCGTCTCC TGG Intergenic
No off target data available for this crispr