ID: 983622482

View in Genome Browser
Species Human (GRCh38)
Location 4:169775086-169775108
Sequence GCAGCCAGGCCCTTAGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983622482_983622488 0 Left 983622482 4:169775086-169775108 CCCGTTTCTAAGGGCCTGGCTGC No data
Right 983622488 4:169775109-169775131 ATTCCTGCGGTCACGATCAGGGG No data
983622482_983622486 -2 Left 983622482 4:169775086-169775108 CCCGTTTCTAAGGGCCTGGCTGC No data
Right 983622486 4:169775107-169775129 GCATTCCTGCGGTCACGATCAGG No data
983622482_983622490 27 Left 983622482 4:169775086-169775108 CCCGTTTCTAAGGGCCTGGCTGC No data
Right 983622490 4:169775136-169775158 TGCTTTCTCCCATCCCCTCCTGG No data
983622482_983622487 -1 Left 983622482 4:169775086-169775108 CCCGTTTCTAAGGGCCTGGCTGC No data
Right 983622487 4:169775108-169775130 CATTCCTGCGGTCACGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983622482 Original CRISPR GCAGCCAGGCCCTTAGAAAC GGG (reversed) Intergenic