ID: 983630915

View in Genome Browser
Species Human (GRCh38)
Location 4:169848407-169848429
Sequence TCTATGAGGGTCATGCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630915_983630921 13 Left 983630915 4:169848407-169848429 CCTCCTTGCATGACCCTCATAGA No data
Right 983630921 4:169848443-169848465 CTCCTTGTTTATGTTCCTGTGGG No data
983630915_983630920 12 Left 983630915 4:169848407-169848429 CCTCCTTGCATGACCCTCATAGA No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630915_983630922 14 Left 983630915 4:169848407-169848429 CCTCCTTGCATGACCCTCATAGA No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983630915 Original CRISPR TCTATGAGGGTCATGCAAGG AGG (reversed) Intergenic