ID: 983630917

View in Genome Browser
Species Human (GRCh38)
Location 4:169848420-169848442
Sequence AGAGGTTGACAGTTCTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983630917_983630920 -1 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630920 4:169848442-169848464 TCTCCTTGTTTATGTTCCTGTGG No data
983630917_983630925 26 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630925 4:169848469-169848491 AACCCTGACTAGAAAAGTGCAGG No data
983630917_983630922 1 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630922 4:169848444-169848466 TCCTTGTTTATGTTCCTGTGGGG No data
983630917_983630921 0 Left 983630917 4:169848420-169848442 CCCTCATAGAACTGTCAACCTCT No data
Right 983630921 4:169848443-169848465 CTCCTTGTTTATGTTCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983630917 Original CRISPR AGAGGTTGACAGTTCTATGA GGG (reversed) Intergenic